Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer: It’s correct because it’s showing an exothermic reaction. x is the reactants and y is the products.
Explanation: -ΔH means the reaction is exothermic and releasing heat. This lowers the potential energy.
<span><em>Answer:</em>
A strontium-90 atom that has a lost two electrons has <u>38</u> protons, <u>52</u> neutrons, and <u>36</u> electrons.
<em>Explanation:
</em>Atomic number<em> of </em>Strontium (Sr) is 38.
<em>Atomic number = number of protons
</em>Hence, Strontium has 38 protons.
If the element is in neutral state,
number of protons = number of electrons.
Then, neutral Strontium atom should have 38 electrons.
But the question says Sr has lost 2 electrons. Hence, number of electrons should be 38 - 2 = 36.
Mass number = number of protons + number of neutrons.
The given mass number is 90. Hence, number of neutrons should be 90 - 38 = 52.</span>
Answer:
CH
Explanation:
We have to obtain the mass of carbon and hydrogen in CO2 and H2O respectively.
For carbon in CO2;
0.845 * 12/44 = 0.23 g
For hydrogen in H20;
0.173 * 2/18 = 0.019 g
We convert the masses to moles of carbon and hydrogen
For carbon - 0.23/ 12 = 0.019 moles
For hydrogen - 0.019/1 = 0.019 moles
Dividing by 0.019 moles for carbon and hydrogen we have the emperical formula of the compound as CH
