1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sweet-ann [11.9K]
3 years ago
10

When ammonium chloride is added to water and stirred, it dissolves spontaneously and the resulting solution feels cold. Without

doing any calculations, deduce the signs of ΔG, ΔH, and ΔS for this process, and justify your choices
Chemistry
1 answer:
d1i1m1o1n [39]3 years ago
7 0
When ammonium chloride NH4Cl is added to water and stirred, it dissolves spontaneously (this is the basis for ΔG) for and the resulting solution feels cold (endothermic, the basis for ΔH). Without doing any calculations, we can easily deduce the signs of ΔG, ΔH, and ΔS for this process based on the observations.

ΔG < 0 (it is spontaneous)
ΔH < 0 (because the process is endothermic - it absorbs energy)
ΔS > 0 (entropy increases because of the dissolution of NH4Cl in water
You might be interested in
Give the complete balanced equation for the reaction that occurs when lithium carbonate (LiCO3) is heated
Eva8 [605]
LiCO3-> LiO+ CO2
It is already balanced as there is one Li on each side, one C on each side and three Os on each side.
5 0
3 years ago
Find an element that has the same
navik [9.2K]

Answer:sodium

Explanation: because its not hard to look on the PERIODIC TABLE

4 0
3 years ago
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
A 5.20 mol sample of solid A was placed in a sealed 1.00 L container and allowed to decompose into gaseous B and C. The concentr
ELEN [110]

Answer:

2.60 moles of A remaining.

Explanation:

According to  Le Chatelier's principle, the equilibrium would shift if the volume, concentration, pressure, or temperature changes.

In this question, we were told that  the volume doubles, that implies that we would have to double the molarity of B/ C (since B=C.)

However, it is obvious and clear from the given equation of the reaction that  A is  solid in it's activity = 1. Hence, it is then ignored.

So doubling B would be 1.30 M × 2 = 2.60 M

i.e 2.60 M moles of A was consumed.

Now;  the number of moles of A remaining  is 5.20 - 2.60 = 2.60 moles of A remaining.

5 0
3 years ago
What is a creative title for dry ice boo bubbles project?
DerKrebs [107]
BBdrice!! LOLOLOL i think its weird but creative
7 0
4 years ago
Read 2 more answers
Other questions:
  • A person with a body temperature of 37°C holds an ice cube with a temperature of 0°C in a room where the air temperature is 20°C
    10·1 answer
  • please help I don’t understand the difference between ammonium and ammonium ion. I possibly did 9.a) correct but part b is a bit
    14·1 answer
  • Help me I promise if you answer all of this first and correctly and I get a good grade i will answer all of your question and I'
    15·1 answer
  • Which New York State landscape region has surface bedrock mostly composed of metamorphic rock
    9·1 answer
  • Calculate the energy of the violet light emitted by a hydrogen atom with a wavelength of 410.1 nm.
    15·1 answer
  • What process is the foundation of almost all food webs
    14·1 answer
  • Need help on 8,9, and 10. ONLY if you know them please.
    15·1 answer
  • Which is an example of an object increasing its kinetic energy
    5·1 answer
  • Guys I know this is not an educational question, but guess what? &gt;.&gt;
    11·2 answers
  • A scientist was asked to test the effect of a new vitamin for rats. His
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!