1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aalyn [17]
3 years ago
11

What process coverts hydrogen to helium to create energy in the sun?

Chemistry
1 answer:
12345 [234]3 years ago
6 0
Thermonuclear fusion
You might be interested in
The pHof a buffer solution containing 0.10 Macetic acid and 0.10 M
zysi [14]

<span>Chemical reaction: CH</span>₃COO⁻(aq) + H⁺(aq) ⇄ CH₃COOH(aq).

H⁺ is from HNO₃: HNO₃ → H⁺ + NO₃⁻.

<span>A buffer can be defined as a substance that prevents the pH of a solution from changing by either releasing or absorbing H</span>⁺ in a solution.

Buffer is a solution that can resist pH change upon the addition of an acidic or basic components and it is able to neutralize small amounts of added acid or base, pH of the solution is relatively stable.

8 0
3 years ago
The student who performed this experiment in the question above wrote the following discussion: "The gas sample is known to cont
Sunny_sXe [5.5K]

Answer:

What was the experimental measurement of the gas?

Explanation:

6 0
3 years ago
Substance that are _________ are unable to be mixed together.
Elza [17]

Answer:

Immiscible

Explanation:

Not sure what kind of substance but this is form liquids.

8 0
3 years ago
Part A
PilotLPTM [1.2K]

Answer:

4200ml

Explanation:

Converting 3.1kg to g

3.1*1000= 3100g

Since density = mass/volume, then

volume = mass/ density

Therefore volume = 3100/0.74

= 4189.2ml

converting it to two significant figures

= 4200ml

6 0
2 years ago
Every organism requires a set of instructions that specifies its traits. Which statement best describes the hereditary informati
Daniel [21]
D genes are located on the chromosomes
7 0
3 years ago
Other questions:
  • When a substance goes from a gas to a liquid, it goes through a ________ change. chemical phase bond nuclear
    10·2 answers
  • Suppose you are given two 1-L flasks and told that one contains a gas of molar mass 30, the other gas of molar mass 60, both at
    11·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • A sentence for desert
    5·2 answers
  • You have an aqueous solution with a ph of 8.0. You add sodium chloride to a concentration of 1 gram per 100 milliliters. What ha
    10·2 answers
  • Write the equilibrium expression for N2 (g) + 3 H2 (g) ↔ 2 NH3 (g) + heat I have no idea where to even start, due to the corona
    8·1 answer
  • If a synthesis reaction takes place between rubidium and bromine, the chemical formula for the product is _____.
    10·2 answers
  • 20.Which of these is a way in which elementsand compounds are similar
    9·1 answer
  • ELABORE 5 QUESTÕES SOBRE EQUILÍBRIO QUÍMICO, ME AJUDEM PFVR!!!!​
    13·1 answer
  • Fields of Study Alferd Wegener
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!