1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solong [7]
3 years ago
6

Determinar los números cuánticos del electrón desapareado en el átomo del cloro (Z = 17) y diga si es paramagnético

Chemistry
1 answer:
Musya8 [376]3 years ago
3 0

Answer:

n = 3

l = 1

ml = +1

ms = +1/2

Es paramagnético

Explanation:

Siguiendo las reglas de llenado de orbitales, los 17 electrones del cloro se llenan así:

1S = <u>⇅</u>

2S = <u>⇅</u>

2P = <u>⇅</u> <u>⇅</u> <u>⇅</u>

3S = <u>⇅</u>

3P = <u>⇅</u> <u>⇅</u> <u>↑</u>

<u />

El número cuántico principal n, es el nivel energético donde se encuentra este electrón:

n = 3 (Porque está en el orbital 3P

El número cuántico secundario, l, para el orbital 3P es  = 1:

l = 1

El número cuántico magnético, ml, es determinado por la posición del electrón. Como está en el tercer orbital 3P:

ml = +1

Y el número cuántico de spin, ms (↑ = +1/2; ↓ = -1/2)=

ms = +1/2

Dado que el último electrón se encuentra desapareado, el cloro es paramagnético dado que el espín de el último electrón no tiene su electrón complementario haciendo que este compuesto pueda interactuar con un campo magnético.

You might be interested in
How to convert 2750 mg to g?
choli [55]

Answer:

2.75 g

Explanation:

divide 2750 by 1000

3 0
3 years ago
What contains elements with similar properties in the periodic table?
Nataly [62]
A) a column

example: earth alkaline metals
6 0
3 years ago
Read 2 more answers
Fluorin is often added to drinking water and toothpaste
Svetradugi [14.3K]
This is true i think if that is a question
4 0
3 years ago
Read 2 more answers
2. Hydrogen gas at a temperature of 22.0°C that is confined in a 5.00L cylinder exerts a pressure of 4.20atm. If the gas is rele
Umnica [9.8K]

Answer: n∗R=22+273.15/4.2∗5n

P2=n∗R∗T2/V2=n∗R∗33.6+273.15/10

Explanation:

4 0
3 years ago
Foods cook faster when placed in a pressure cooker. This is because the pressure on the surface of the water is (higher than/low
tia_tia [17]

Answer:

The pressure is higher than the atmospheric one, therefore the temperature is less.

Explanation:

When it is closed permanently, the pressure of the pot inside it increases, generating that the atoms and particles of the water are closer together, increasing their kinetic energy, if intermolecular friction and therefore the boiling point is lower, because the water reaches a boil or boil at a lower temperature.

5 0
2 years ago
Other questions:
  • Which of the following would be part of an aquatic ecosystem?
    5·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What can you say about the relationship between temperature and volume?
    12·1 answer
  • A chemical bond is formed between magnesium and chlorine. Describe the process and identify the nature of the chemical bond.
    6·1 answer
  • The steps to balancing a neutralization reaction when given a verbal description can be summarized as follows: Write the chemica
    8·1 answer
  • The molecule H2O can be correctly described as a?
    6·1 answer
  • 3. The Periodic Law states that the chemical
    11·1 answer
  • Liability that arises from not maintaining a building is referred to as a) medical foundation liability. b) premises liability.
    7·1 answer
  • For X + Y → XY, if [XY] is increasing at a rate 0.10 M s-1, predict the rate of depletion of both reactants.
    13·1 answer
  • Nguyên tố A có nguyên tử khối nặng gấp 4 lần nguyên tử oxi. A là
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!