The 3d sublevel is not filled until after the 4s sublevel, because the 3d sublevel has more energy than the 4s sublevel, and less energy than the 4p sublevel. (:
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
531–1532 – Pizarro's third voyage to Peru. Spaniards form a bond with the Natives (Huancas, Chankas, Cañaris and Chachapoyas) who were under the oppression of the Inca Empire, and Pizarro includes them among his troops to face the Incas. Atahualpa is captured by Spanish.
Explanation: Is this right ?
if it is please give thanks
Answer:
the answer is 70.906 g/mol
Explanation:
