1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivann1987 [24]
3 years ago
11

Why do lone pairs of electrons repel other electrons pairs farther away than bonding pairs of electrons do?

Chemistry
1 answer:
Nikolay [14]3 years ago
6 0
Because a bonding electron pair is involved in a sigma bond with another atom. Hence is at a greater distance from the nucleus of the central atom than a non bonding pair



You might be interested in
Which of the following can be used to neutralize an ammonia (NH3) solution?
german
Water or also known as H2O
6 0
3 years ago
Help! Need it ASAP!<br> Is steam and vapour different? If they are then how are they different?
Alexxx [7]

Answer:

Explanation:

Water vapor is when water molecules are present in the air, while steam is water heated to the point that it turns into gas. In simplified science, both are referred to as the gaseous state of water. Steam is usually white or translucent in nature, while water vapor can be clear or translucent.

Steam is simply, water vapor. Hence, the key difference between steam and vapor is that steam is the gaseous state of water whereas vapor is the gaseous state of any substance. Moreover, steam is typically invisible while the vapor of some substances is colorful.

8 0
3 years ago
Read 2 more answers
2. What effect does temperature have on the strength of a magnet?
DIA [1.3K]

Answer:

The more the temperature the less the effect if magnet

4 0
2 years ago
How many atoms of nitrogen are present in 2.49 moles of nitrogen trifluoride ? atoms of nitrogen?
stepladder [879]
<span>Nitrogen trifluoride - NF3.
1 mol NF3 contains 1 mol atoms of Nitrogen
2.49 mol NF3 contains 2.49 mol atoms of Nitrogen

1 mol   ----  6.02 *10²³ atoms
2.49 mol ----- 2.49*6.02*10²³ = 15.0*10²³ atoms of N</span>
6 0
2 years ago
How much energy do individual photons of 470 nm light have
IceJOKER [234]
<h3>Answer:</h3>

4.227 × 10^-19 Joules

<h3>Explanation:</h3>

Energy of a photon of light is calculated by the formula;

E = hf, where h is the plank's constant, 6.626 × 10^-34 J-s and f is the frequency.

But, f = c/λ

Where, c is the speed of light (2.998 × 10⁸ m/s), and λ is the wavelength.

Given the wavelength is 470 nm or 4.7 × 10^-7 m

Therefore;

E = hc/λ

  = (6.626 × 10^-34 J-s × 2.998 × 10^8 m/s) ÷ 4.7 × 10^-7 m

  = 4.227 × 10^-19 Joules

Therefore, the energy of a photon with 470 nm is 4.227 × 10^-19 Joules

3 0
3 years ago
Other questions:
  • Given the redox reaction: Ni + Sn4+ → Ni2+ + Sn2+<br> Which species has been oxidized?
    9·1 answer
  • Why can a liquid change to take the shape of its container but NOT expand to fill the container itself?
    13·2 answers
  • If a solution has a pOH of 8.71, what is the [H+]?
    5·1 answer
  • Brain, Spinal Cord
    15·2 answers
  • A first place finisher in a cross country meet ran 5,000 meters in 871.7 seconds. What was his average speed?​
    15·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Convert the given amount as noted.
    9·1 answer
  • What quantity of potassium phosphate, in grams, is required to prepare 500.0 ml of solution where you the concentration of potas
    11·1 answer
  • Please help, lol :)) &lt;--------------
    8·1 answer
  • Which label belongs in the area marked X? can reproduce by budding can reproduce by fragmentation with regeneration reproduce in
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!