Answer:4.42 g= 1 mol/55.845 =.079 moles of Fe
Explanation:Given 4.42 grams of Fe. The atomic weight of Fe(iron) found on the periodic table is 55.845. Divide grams by the atomic weight to convert to moles.
Answer:
4.81 moles
Explanation:
The total pressure of the gas = Pressure at which gauge reads zero + pressure read by it.
Pressure at which gauge reads zero = 14.7 psi
Pressure read by the gauge = 988 psi
Total pressure = 14.7 + 988 psi = 1002.7 psi
Also, P (psi) = P (atm) / 14.696
Pressure = 1002.7 / 14.696 = 68.2297 atm
Temperature = 25 °C
The conversion of T( °C) to T(K) is shown below:
T(K) = T( °C) + 273.15
So,
T = (25 + 273.15) K = 298.15 K
Volume = 1.50 L
Using ideal gas equation as:
PV=nRT
where,
P is the pressure
V is the volume
n is the number of moles
T is the temperature
R is Gas constant having value = 0.0821 L.atm/K.mol
Applying the equation as:
68.2297 atm × 1.5 L = n × 0.0821 L.atm/K.mol × 298.15 K
⇒n = 4.81 moles
Answer: The squirrel's balloon will be 0.86 L
Explanation:
To calculate the new volume, we use the equation given by Boyle's law. This law states that pressure is directly proportional to the volume of the gas at constant temperature.
The equation given by this law is:
where,
are initial pressure and volume.
are final pressure and volume.
We are given:
Putting values in above equation, we get:
Thus the squirrel's balloon will be 0.86 L
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
sample B contains the larger density
Explanation:
Given;
volume of sample A, V = 300 mL = 0.3 L
Molarity of sample A, C = 1 M
volume of sample B, V = 145 mL = 0.145 L
Molarity of sample B, C = 1.5 M
molecular mass of sodium chloride, Nacl = 23 + 35.5 = 58.5 g/mol
Molarity is given as;
The reacting mass for sample A = 0.3mol x 58.5 g/mol = 17.55 g
The reacting mass for sample B = 0.2175 mol x 58.5 g/mol = 12.72 g
The density of sample A 
The density of sample B 
Therefore, sample B contains the larger density
