1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natali5045456 [20]
3 years ago
15

When silver coins are found in ancient shipwrecks,they are coated with a black crust. What question could you ask to help you de

cide whether the silver underwent a chemical change or a physical change? Explain.
Chemistry
1 answer:
leonid [27]3 years ago
8 0
It went under a physical change because it (1) changed color. (2) changed form.
You might be interested in
Enough of a monoprotic acid is dissolved in water to produce a 0.0121 M solution. The pH of the resulting solution is 6.49. Calc
Hitman42 [59]
Calculate the H positive from the pH equation: pH equals -log (H positive). This would be 10 to the -6.49. Let's call the acid HA. To calculate Ka in this equation, Ka equals H positive times A- over HA. HA is going to be the 0 0121. So, Ka=(10^-6.49)^2/0.0121. This equals 1.05*10^-13/0.0121. Ka then equals 8.65*10^-12.
4 0
3 years ago
Most metals are solid at room temperature, malleable, ductile, good conductors of heat and electricity, and react in acids to pr
Evgen [1.6K]

Answer:

The answer to your question is:   "react with acids to produce hydrogen gas"

Explanation:

Chemicals properties of matter: are properties that can be measured if there is a chemical change or chemical reaction.

Examples of chemical reactions:

Reactivity

Toxicity

Coordination number

Flammability

Of the properties listed, the only that implies a reaction is "react with acids to produce hydrogen gas"

7 0
3 years ago
Read 2 more answers
A 0.500-g sample of KCl is added to 50.0g of water in a calprimeter (Figure 5.12) If the temperature decreases by 1.05C. what is
Sauron [17]

Answer : The reaction is endothermic.

Explanation :

Formula used :

Q=m\times c\times \Delta T

where,

\Delta T = change in temperature = 1.05^oC

Q = heat involved in the dissolution of KCl = ?

m = mass = 0.500 + 50.0 = 50.5 g

c = specific heat of resulting solution = 4.18J/g^oC

Now put all the given value in the above formula, we get:

Q=50.5g\times 4.18J/g^oC\times 1.05^oC

Q=+221.64J

The heat involved in the dissolution of KCl is positive that means as the change in temperature decreases then the reaction is endothermic and as the change in temperature increases then the reaction is exothermic.

Hence, the reaction is endothermic.

8 0
3 years ago
Calculate the ΔG°rxn using the following information at 298K. 2 HNO3(aq) + NO(g) → 3 NO2(g) + H2O(l) ΔG°rxn = ? ΔH°f (kJ/mol) -2
Mkey [24]

Answer:

ΔG°rxn = +50.8 kJ/mol

Explanation:

It is possible to obtain ΔG°rxn of a reaction at certain temperature from ΔH°rxn and S°rxn, thus:

<em>ΔG°rxn = ΔH°rxn - T×S°rxn (1)</em>

In the reaction:

2 HNO3(aq) + NO(g) → 3 NO2(g) + H2O(l)

ΔH°rxn = 3×ΔHfNO2 + ΔHfH2O - (2×ΔHfHNO3 + ΔHfNO)

ΔH°rxn = 3×33.2kJ/mol + (-285.8kJ/mol) - (2×-207.0kJ/mol + 91.3kJ/mol)}

ΔH°rxn = 136.5kJ/mol

And S°:

S°rxn = 3×S°NO2 + S°H2O - (2×S°HNO3 + S°NO)

ΔH°rxn = 3×0.2401kJ/molK + (0.0700kJ/molK) - (2×0.146kJ/molK + 0.2108kJ/molK)

ΔH°rxn = 0.2875kJ/molK

And replacing in (1) at 298K:

ΔG°rxn = 136.5kJ/mol - 298K×0.2875kJ/molK

<em>ΔG°rxn = +50.8 kJ/mol</em>

<em />

7 0
3 years ago
Read 2 more answers
Why is photosynthesis important to the ecosystem everywhere
topjm [15]

It creates  oxygen which every living thing needs to live. i hope this helps! :)

7 0
3 years ago
Other questions:
  • The chemical combination of two or more different atoms in fixed amounts is called a(n)?
    15·1 answer
  • The molar mass of lif is 25.94 g/mol. how many moles of lif are present in 10.37 g?
    6·2 answers
  • Sedimentary rocks formed from the remains of once-living things are
    10·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The formula actual yield / theoretical yield is used to calculate the ____ yield of a reaction.
    11·2 answers
  • Which of the following represents an inorganic compound? A. C6H12O6 B. C2H4O C. C2H5NO2 D. FeSO4
    5·2 answers
  • Propane (C3H3) is used in domestic cooking and heating. A typical home in Pennsylvania burns 750 gal of propane for heating over
    13·1 answer
  • How is your day today?
    7·2 answers
  • How do jet streams affect temperature and precipitation?
    12·1 answer
  • What type of chemical reaction is Ba(ClO3)2 --&gt; BaCl2 + O2.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!