1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kisachek [45]
3 years ago
15

Which two elements have similar characteristics?

Chemistry
2 answers:
Illusion [34]3 years ago
8 0
Lithium and potassium have similar characteristics

ycow [4]3 years ago
3 0
I would say Lithium and calcium
You might be interested in
I NEED THE REVERSE ABILITIES ASAP!!!!!!
nikitadnepr [17]

Answer:

physical property: Any characteristic that can be determined without changing the substance's chemical chemical properties: Any characteristic that can be determined only by changing a substance's molecular structure.

1. Meting of a solid and vaporisation of a liquid are reversible processes. On reversing the conditions under which these processes occur, the liquid can be converted black into solid and vapour into liquid.

2. All isothermal and adiabatic processes, in which no loss of heat occurs due to conduction, convection or radiation can be retraced reversing the boundary conditions and hence these are reversibly processes.

6 0
3 years ago
Which subatomic particles have a positive charge and are located in the nucleus?
d1i1m1o1n [39]

Answer: Atomic Particles

Explanation:

toms consist of three basic particles: protons, electrons, and neutrons. The nucleus (center) of the atom contains the protons (positively charged) and the neutrons (no charge). The outermost regions of the atom are called electron shells and contain the electrons (negatively charged).

8 0
3 years ago
The molecular weight of table salt, NaCl, is 58.5 g/mol. A tablespoon of salt weighs 6.37 grams. Calculate the number of moles o
cestrela7 [59]

Answer:

The number of moles of salt in one tablespoon is = <u>0.11 mole</u>

<u>Grams </u>cancel each other.

Explanation:

<u>Moles</u> : It is the unit of quantity . It is the mass of the substance present in exactly 12g of C-12.

moles=\frac{given\ mass}{Molar\ mass}

<u>Moles Calculation:</u>

Given mass = 6.37  gram

Molar mass = 58.5 g/mol

moles=\frac{6.37}{58.5}

= 0.1088

= 0.11 mole

<u>Units calculation</u>

moles=\frac{given\ mass}{Molar\ mass}

moles=\frac{g}{g/mole}

moles=\frac{g}{g}\times mole

<u>g ang g cancels each other </u>

moles = moles

<u>Hence unit = gram (g ) cancel each other.</u>

3 0
3 years ago
Read 2 more answers
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
A sample of gas occupies 806 mL at 26 degrees c and 1 atm. Find the volume of the gas at STP
Varvara68 [4.7K]
The standard temperature and pressure is 273 K and 1 atm. Since, pressure is not changed we can use Charle's law for the calculations.

<span>Charle's law says "at a constant pressure, the volume of a fixed amount of gas is directly proportional to its absolute temperature".

V α T 

Where V is the volume and T is the temperature in Kelvin of the gas. We can use this for two situations as,
V</span>₁/T₁ = V₂/T₂<span>

</span>V₁ = 806 mL<span>
T</span>₁ = 26 ⁰C = 299 K
V₂ <span>= ? </span><span>
T</span>₂ = 273 K<span>
<span>
By applying the formula,
</span></span>(806 mL / 299 K) = (V₂ / 273 K)

                       V₂ = 735. 91 mL

<span>
Hence, the answer is "a".</span>

6 0
3 years ago
Other questions:
  • What do we need to survive and how long for
    8·2 answers
  • What energetic travels through space in the form of waves?
    10·1 answer
  • Cavendish’s name for hydrogen gas was "inflammable air." The word inflammable means "to burn. "Why did Cavendish use this name?
    14·2 answers
  • Sulphur is non metal why​
    14·2 answers
  • How many grams of calcium cyanide (Ca(CN)2) are contained in 0.79 mol of calcium cyanide?
    12·1 answer
  • What effect does the ph of smoke have on water in the atmosphere?
    7·2 answers
  • A chemical equation is balanced if the number of each type of atom on the left side is equal to the number of each type on the r
    6·2 answers
  • Which formula contains 2 non metals
    5·1 answer
  • How can wind produce erosion?
    9·1 answer
  • Distinguish between the crust and and the lithosphere
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!