Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
Natural Selection
Explanation:
In natural selection process of evolution, traits that are essential for an individual to be fit enough to survive under environmental stress become dominant.
Since the flowers are of blue or yellow color, it is essential for a bee to be able enough to perceive the blue and yellow color. Hence, the eyes of bee with time have evolved to perceive these two color so that they can pollinate flower.
Answer:
White eyes are lethal in male Drosophila was the hypothesis of Thomas hunt which was valid. Hence the answer is option B.
Explanation:
Thomas hunt Morgan was a famous American biologist. He was more famous because of his experiment on drosophila which contributed most of things about the lifestyle and health science in much of the findings about those insects.
He was also awarded by the Nobel prize for his works which was related to medicine in 1933. He has also contributed many knowledge about the chromosome and heredity. he is finding is very helpful nowadays for the scientist and other biologist.
Answer:
developmental toxicity. im not sure though,
Explanation:
if im wrong im sorry
Answer:
Explanation:
You list the references in order of the last name of the author. For instance a book by Zachary Adam would come before a book by Adam Zachary. (Just an example)
Adam, Zachary. "Works Cited Example 1." Place of Publication: Publisher, Year.
Zachary, Adam. "Works Cited Example 2." etc.
