1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nika2105 [10]
4 years ago
11

Resistance is caused by _________________in a current bumping into electrons and ions in the matter through which the current is

flowing.
electrons


matter


protons


neutrons
Chemistry
1 answer:
zysi [14]4 years ago
8 0
The answer is protons
You might be interested in
A word which describes a solution which is more dilute than cytoplasm and would cause a cell to swell with water
Snowcat [4.5K]

Answer:

A hypertonic solution has increased solute, and a net movement of water outside causing the cell to shrink. A hypotonic solution has decreased solute concentration, and a net movement of water inside the cell, causing swelling or breakage.

Explanation: hope this helps :) sorry if it's wrong :(

6 0
3 years ago
One gallon milk is equal to how many milliliters of milk?
Black_prince [1.1K]

Answer:

3785.411784 mL

Explanation:

6 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Acellus<br> How many grams of strontium<br> (Sr, 87.62 g/mol) are in 2.92<br> moles of strontium?
saul85 [17]

Answer:

There are 255, 85 grams of Strontium in 2,92 moles.

Explanation:

We perform a simple rule of three to calculate the number of grams, knowing that one mole of Sr weights 87, 62 grams:

1 mol Sr---------87, 62 grams

2,92 mol Sr-----x=(2,92 mol Sr x-87, 62 grams)/1 mol Sr= 255,8504 grams

5 0
3 years ago
Need help with 22 and 24<br>​
choli [55]

Answer:

22:

Formular:

atomic \: mass =  \frac{ \sum(isotopic \: mass \times \%abundance)}{100}  \\

substitute:

atomic \: mass =  \frac{(23.985 \times 78.70) + (24.986 \times 10.13) + (25.983 \times 11.17)}{100}  \\  \\  =  \frac{(1887.620) + (253.108) + (290.230)}{100}  \\  \\  =  \frac{2430.958}{100}  \\  \\ { \boxed{ \boxed{average \: atomic \: mass = 24.3 \: amu}}}

23:

<em>Same</em><em> </em><em>element</em><em> </em><em>is</em><em> </em><em>represented</em><em> </em><em>by</em><em> </em><em>same</em><em> </em><em>number</em><em> </em><em>of</em><em> </em><em>protons</em><em>.</em><em> </em>

Answer:

6 protons. 6 protons

7 neutrons. 8 neutrons

6 electrons. 6 electrons

Note: <u>Atoms</u><u> </u><u>with</u><u> </u><u>same</u><u> </u><u>proton</u><u> </u><u>number</u><u> </u><u>but</u><u> </u><u>different</u><u> </u><u>mass</u><u> </u><u>number</u><u> </u><u>are</u><u> </u><u>called</u><u> </u><u>isotopes</u>

5 0
3 years ago
Read 2 more answers
Other questions:
  • How many valence electrons are in an atom of bromine?
    8·1 answer
  • "The composting process is the A conversion of organic waste into soil conditioners or mulch. B.redesign of chemical processes t
    5·1 answer
  • What is the approximate depth of the calcite compensation depth (CCD) in the ocean? View Available Hint(s) What is the approxima
    15·1 answer
  • Frequency of 6.98 x 1013
    8·1 answer
  • A certain shade of blue has a frequency of 7.00 × 1014 Hz. What is the energy of exactly one photon of this light?
    8·2 answers
  • _____ net forces cause objects to change their motion. A. Zero B. Applied C. Balanced D. Unbalanced
    13·2 answers
  • What is the importance of different types of mirrors and lenses?​
    8·1 answer
  • Describe a covalent bond?
    15·1 answer
  • Which of the following best describes topsoil?
    14·1 answer
  • How can you tell the difference between two clear liquids
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!