1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fittoniya [83]
3 years ago
11

Choose all the answers that apply. Which of the following would cause an increase in heat?

Chemistry
2 answers:
DochEvi [55]3 years ago
7 0
<span>Choose all the answers that apply. Which of the following would cause an increase in heat?

A.friction
</span>
bija089 [108]3 years ago
6 0
I would say A. Friction because it is the act of two things rubbing together.

Ex. Trying to make fire
You might be interested in
Identify the correct descriptions of beta particles.
FrozenT [24]

Answer:

a. A beta particle has a negative charge. d. A beta particle is a high-energy electron.

Explanation:

Identify the correct descriptions of beta particles.

a. A beta particle has a negative charge. YES. A beta particle is originated in the following nuclear reaction: ¹₀n ⇒ ¹₁H + ⁰₋₁e (beta particle.)

b. A beta particle contains neutrons. NO. It is a electron originated in the nucleus.

c. A beta particle is less massive than a gamma ray. NO. Gamma rays don't have mass while a beta particle has a mass which is half of one thousandth of the mass of a proton.

d. A beta particle is a high-energy electron. YES. Beta particles are nuclear originated hig-energy electrons.

6 0
3 years ago
Which of the following is a salt? <br> C6H12O6<br><br> O2<br><br> C2H2<br> K C l
irina [24]

Answer:

it's kcl

Explanation:

the kcl should be salt

5 0
2 years ago
Alchemists in the Middle Ages dreamed of converting base metals, such as lead, into precious metals—gold and silver. Why could t
lesantik [10]

Explanation:

Each element in the periodic table has different but fixed number of the protons in nucleus of it's atom, which is known as the atomic number.

Transmutation of one chemical element into the another involves the changing of the atomic number. Such nuclear reaction requires millions of the times more energy as compared to normal chemical reactions. Thus, the dream of  the alchemist of transmuting the lead into the gold was never achievable chemically .

Conversion of lead to gold in today's world:

This conversion is indeed possible. The requirements are a particle accelerator, tremendous supply of the energy. Nuclear scientists at the Lawrence Berkeley National Laboratory located in California, more than 30 years ago, succeeded in producing very minute amounts of the gold from the bismuth. Bismuth is a metallic element which is adjacent to the lead on periodic table. Same process would work for the lead but isolating gold at end of reaction would prove much more difficult because lead is available in many isotopes. The homogeneous nature of the element means that it is easier to separate the gold from the bismuth as compared to separate the gold from the lead which has four  isotopic identities which all are stable.

4 0
3 years ago
24 POINTS!!!!!!!!!!
Oliga [24]
Your answer is going to be A, because it was shoved harder, it will go faster

8 0
3 years ago
Read 2 more answers
Which has the greater polarizing power, Li+ or Be2+ and why?
kvasek [131]

Answer:

Polarizing power refers to an atoms ability to pull an electron toward it, polarizing the atom the electron comes from. Since cations are positive, they are able to attract electrons toward themselves. Anions are negative and so do not attract more electrons.

Therefore, Be2+ has a higher polarizing power because it has a higher quantitiy of protons, hence a higher polarizing power.

4 0
3 years ago
Other questions:
  • How many miles of NaCl are in 250 mL of a 0.4 M solution?​
    6·1 answer
  • What is the density of carbon dioxide gas if 0.196g occupies a volume of 100 mL
    10·1 answer
  • In a room full of air, the air is mainly composed of Nitrogen and Oxygen molecules (both at room temperature). Find (to two sign
    9·1 answer
  • When the vapor pressure of a liquid is equal to the atmospheric pressure, the liquid
    8·1 answer
  • PLEASE HELP ASAP SCIENCE!!!!Which of the following is a main function of a stem? to store food for the plant to bring water to t
    10·1 answer
  • Beaches along the eastern and western coasts of North America are composed chiefly of quartz grains.
    14·1 answer
  • What is the mass of oxygen in 10g of water
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Plant Cell
    10·1 answer
  • 50 Two chemicals are mixed and sold in a plastic bag The bag begins to inflate and becomes hot to the touch. what evidence suppo
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!