1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
guapka [62]
3 years ago
11

Explain what is wrong with this statement: “The density of a heavy bar of pure gold is greater than the density of a small ingot

of pure gold."
Chemistry
1 answer:
VladimirAG [237]3 years ago
5 0

Answer:

Both densities would be equal.

Explanation:

since both the bar and the ingot are pure gold, they would have the same density, despite the amount.

You might be interested in
In order for a process to be spontaneous, Multiple Choice the entropy of the surroundings must increase. the entropy of the surr
Crazy boy [7]

Answer:

The correct answer is entropy change of the surrounding plus the entropy change of the system must be positive.

Explanation:

The term entropy is a state function.Entropy can be defined as the disorder or randomness of the molecules in a system.

 A spontaneous reaction is a type of reaction which deals with the release of free energy.The change of free energy in case of spontaneous reaction is always negative.

 According to the second law of thermodynamics a spontaneous reaction will occur in a system if the total entropy of both  system and surrounding increases during the reaction.

8 0
3 years ago
All of the following are part of the electromagnetic spectrum but
Lelechka [254]
Your answer is radio waves
6 0
4 years ago
How many milliliters of a 3.0 M HCL solution are required to make 250.0 millimeters of 1.2 M HCL?
White raven [17]
The problem above can be solved using M1V1=M2V2  where M1 is the concentration of the concentrated, V1 is the volume of the concentrated solution, M2 is the concentration of the Dilute Solution, V2 is the Volume of the dilute solution. Hence,

(3.0 M)(V2)=(250 mL)(1.2M)
V2 (3.0)= 300
V2= 100 mL

Therefore, you need 100 mL of 3.0 M HCl to form a 250 mL of 1.2 M HCl.
7 0
3 years ago
Permanently frozen soil is called what?
Kazeer [188]
It is called permafrost :)
8 0
3 years ago
Read 2 more answers
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
Other questions:
  • Which diatomic molecule is formed when the two atoms share six electrons
    5·2 answers
  • Where would you expect to find an element with the greatest electronegativity?
    7·1 answer
  • Using a blow dryer to dry your hair is an example of conduction, convection, or radiation?
    14·2 answers
  • A package of aluminum foil is 63.2 yd long, 11 in. wide, and 0.00035 in. thick. If aluminum has a density of 2.70 g/cm³, what is
    5·1 answer
  • What is acid rain? Please answer it as fast as possible....I really need it......
    9·2 answers
  • Is cobalt chloride solution a conductor or an insulator
    7·2 answers
  • How many Group 17 elements are in Period 3 of the Periodic Table? A) 1 B) 2 C) 3 D) 4
    6·1 answer
  • Which one of these is an example of a virus that can affect a range of hosts? A) the varicella virus B) the rabies virus C) the
    8·1 answer
  • 1) Convert the following:<br> 900g to kg<br><br> 2.87L to uL
    6·1 answer
  • What is the number of protons plus the number of neutrons in the nucleus of an atom equivalent to?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!