Answer:
Explanation:
The period law state that when elements are listed in order of their atomic numbers, the elements fall into recurring groups, so that there is a recurrence of similar properties at regular intervals.
Na and K in the periodic table fall into the same group, this is because they both have one electrons in their outermost shell.
Na 11 -1s2 2s2 2p6 3s1
K 19 - 1s2 2s2 2p6 3s2 3p6 4s1
They share similar chemical and physical properties. Na and K are very reactive metals, they can loose/donate their outermost electron to non metals in other to attain stable octet state.
The form ionic compound when they react with non metals.
Every substance is either an element or a compound.
There is ionic compounds, molecular compounds, but they are all considered compounds.
Hope I helped.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Magnesium + Hydrocloric acid -> Magnesium chloride + hydrogen
You can observe a single displacement reaction
"Describe to show that the has formed is hydrogen"
I don't know what you mean. I can show the chemical equation though.
Mg(s) + 2 HCl(aq) --> MgCl 2(aq) + H 2(g)
Answer:
Answer the last one Nuclear decay rates vary, but chemical reaction rates are constant
Explanation:
Correct me if im wrong
