1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Allushta [10]
3 years ago
15

What is another name for a beta minus (β–) particle?

Chemistry
1 answer:
marusya05 [52]3 years ago
3 0
U can use a beta ray
Hope this is what u want
Good luck
You might be interested in
Part B Write the balanced chemical equation for the neutralization reaction that occurs when an aqueous solution of hydrobromic
Doss [256]

Answer:

HBr(aq) + LiOH(aq) → LiBr(aq) + H2O(l)

Explanation:

A neutralization reaction is a process in which an acid, aqeous HBr reacts completely with an appropriate amount of base, aqueous LiOH to produce salt, aqueous LiBr and water, liquid H2O only.

HBr(aq) + LiOH(aq) → LiBr(aq) + H2O(l)

Acid + base → Salt + Water.

During this reaction, the hydrogen ion, H+, from the HBr is neutralized by the hydroxide ion, OH-, from the LiOH to form the water molecule, H2O.

Thus, it is called a neutralization reaction.

4 0
3 years ago
Why is oxygen written with a subscript 2 in CO2?
Alexeev081 [22]

Answer:

Explanation:

the answer is b

6 0
4 years ago
Read 2 more answers
Carbon can react with oxygen to form carbon dioxide. Which of the following statements about this chemical change is true?
wlad13 [49]

Carbon can react with oxygen to form carbon dioxide. Which of the following statements about this chemical change is true? ... Carbon and oxygen atoms are destroyed as new atoms are formed. Carbon and oxygen atoms have the same properties as molecules of carbon dioxide.

6 0
3 years ago
Were would you be if all the stars you see are circumpolar
8_murik_8 [283]
At the Earth's North Pole, the north celestial pole is directly overhead, and all stars that are visible at all (that is, all stars in the northern celestial hemisphere) are circumpolar. As one travels south, the north celestial pole moves towards the northern horizon
3 0
3 years ago
If the density of a liquid is 20g/mL and the volume is 70mL, what is the mass?
Archy [21]

Answer:

mass= volume ×density

20×70=1400 g

3 0
3 years ago
Other questions:
  • Place the following substances in the following order: soluble, somewhat soluble, and insoluble.
    15·1 answer
  • What are the correct units of measure for molarity?
    12·1 answer
  • If 15g of iron reacts with 8.5g of oxygen, how many grams of iron oxide will be produced
    14·1 answer
  • Kilograms represented by the mass defect for oxygen-16: 2.20 × 10 -28 kg What is the nuclear binding energy for oxygen-16?
    15·2 answers
  • Imagine that Ana has a block made of pure gold. If she cuts this block into two equal pieces, pick the statement that best descr
    9·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Gold(ill) hydroxide is used in medicine, porcelain making, and gold plating. It is quite insoluble in aqueous solution. Which of
    6·1 answer
  • Charlotte is driving at 56.0 mi/h and receives a text message. She looks down at her phone and takes her eyes off the road for 3
    15·1 answer
  • Is electrical conductivity an extensive property or an intensive property?
    8·1 answer
  • What does potassium hydroxide and sulphuric acid make?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!