1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katrin [286]
4 years ago
13

Nitrogen (N) is element number 7 in the periodic table. It has a mass number of 14. Nitrogen

Chemistry
1 answer:
Jet001 [13]4 years ago
5 0
The answer is ISOTOPE
You might be interested in
.500 mol of br2 and .500 mol of cl2 are placed in a .500L flask and allowed to reach equilibrium. at equilibrium the flask was f
Tasya [4]

Answer : The value of K_c for the given reaction is, 0.36

Explanation :

Equilibrium constant : It is defined as the equilibrium constant. It is defined as the ratio of concentration of products to the concentration of reactants.

The equilibrium expression for the reaction is determined by multiplying the concentrations of products and divided by the concentrations of the reactants and each concentration is raised to the power that is equal to the coefficient in the balanced reaction.

As we know that the concentrations of pure solids and liquids are constant that is they do not change. Thus, they are not included in the equilibrium expression.

The given equilibrium reaction is,

Br_2(aq)+Cl_2(aq)\rightleftharpoons 2BrCl(aq)

The expression of K_c will be,

K_c=\frac{[BrCl]^2}{[Br_2][Cl_2]}

First we have to calculate the concentration of Br_2,Cl_2\text{ and }BrCl.

\text{Concentration of }Br_2=\frac{Moles}{Volume}=\frac{0.500mol}{0.500L}=1M

\text{Concentration of }Cl_2=\frac{Moles}{Volume}=\frac{0.500mol}{0.500L}=1M

\text{Concentration of }BrCl=\frac{Moles}{Volume}=\frac{0.300mol}{0.500L}=0.6M

Now we have to calculate the value of K_c for the given reaction.

K_c=\frac{[BrCl]^2}{[Br_2][Cl_2]}

K_c=\frac{(0.6)^2}{(1)\times (1)}

K_c=0.36

Therefore, the value of K_c for the given reaction is, 0.36

6 0
3 years ago
Read 2 more answers
When Lithium-7 loses 1 electron it
IrinaK [193]

If it loses an electron, it will become an ion.

8 0
3 years ago
Read 2 more answers
What does it mean for a reaction to release energy?.
8090 [49]

Answer:

exothermic

Explanation:

4 0
3 years ago
Read 2 more answers
How many moles of glucose can be produced
Arturiano [62]

Answer:

moles of glucose

<u>2.3166 moles of glucose</u>

<u></u>

Explanation:

The balance reaction for the formation of glucose is :

6CO_{2}+6H_{2}O\rightarrow C_{6}H_{12}O_{6}+6O_{2}

here , CO2 = carbon dioxide

H2O = water

C6H12O6 = glucose

O2 = Oxygen

According to this equation :

6 mole of CO2 = 6 mole of H2O = 1 mole of C6H12O6 = 6 mole of O2

We are asked to calculate the mole of Glucose from carbon dioxide.

So,

6 mole of CO2  produce = 1 mole of C6H12O6

1 mole of CO2 will produce =

\frac{1}{6} moles of glucose

13.9 moles of CO2 will produce :

\frac{1}{6}\times 13.9

=2.3166 moles of glucose

Note : first , Always calculate for one mole (By dividing)

. After this , multiply the answer with the moles given.

Always write the substance whose amount is asked(glucose) to the right hand side

5 0
4 years ago
After the death of living material, the ratio of carbon-12 to carbon-14 isotopes in the material;
Ad libitum [116K]
Decrease on edg 2020
3 0
3 years ago
Other questions:
  • Which of the following describes qualitative data
    14·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • A solution in which the pH is 1.6 would be described as
    7·1 answer
  • A liquid at room temperature with high vapor pressure has:
    14·1 answer
  • Answer (example of a bar graph)
    7·1 answer
  • What is the difference between a subscript and a coefficient in a chemical reaction?​
    15·1 answer
  • Pls help me solve those.Thank youu!
    15·1 answer
  • Why is the regression equation not exactly y = 100 • 0.5n?
    14·1 answer
  • A)<br> What is an ELECTRIC CELL?<br> DEL
    11·2 answers
  • Which of the following in the definition of control?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!