1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tangare [24]
3 years ago
9

An example of a potassium compound containing both ionic and covalent bonds is?

Chemistry
1 answer:
gayaneshka [121]3 years ago
4 0
It's a trick question because all of them contain both iconic and covalent bonds.

Hope it helps!! :) have fun
You might be interested in
You want to create 14.0 g of copper to meld into a piece of jewelry. You
Yuki888 [10]

Answer:

3.4g of Al

Explanation:

you would need to start with 3.4 g of Al

3 0
3 years ago
How many kilocalories are needed to vaporize 5.8 mol of Br2
Valentin [98]
<span>The vaporization of br2 from liquid to gas state requires 7.4 k/cal /mol.</span>
8 0
3 years ago
What is the voltage for the nonspontaneous reaction between silver (Ag) and copper (Cu) and their ions?
gayaneshka [121]
For an non spontaneous reaction between silver (Ag) and copper (Cu) and their ions, Cu is the oxidizing agent while Ag+ is the reducing agent,
The following reactions will take place;
Anode Cu = Cu+2 + 2e-   E= +0.34 volts
Cathode; Ag+ + e = Ag    E = +0.80 volts
The net reaction will be Cu + 2Ag+ = Cu+2 + 2Ag
Thus, the voltage will be
  = +0.80 - (+0.34)
5 0
3 years ago
Select the correct answer.
bazaltina [42]

C. Magma from venus mantle erupted as lava.

Explanation:

A volcano is a land form which results from the eruption of molten rocks (lava) on the surface. Volcanic rocks are a special type of igneous rock that forms when molten rock cools and solidifies on the surface.

For a planet like Venus which is presently not active and little to no movement occurs within the plates, the volcanisim must have occurred when the planet was relatively young and it must have been millions of years ago.

It is widely believed that Venus was geologically active in times past. Mantle generated lava must have solidified on the surface in times past to have formed the volcano.

Evaluating other options:

Impact of space objects on Venus would lead to the formation of a crater which is a depression on the surface. The rock would be mostly metamorphic.

If water was ever present in Venus, they would have produced sedimentary rocks instead. The erosive power of water is not high enough to cut through the crust. Also, water would not aid the formation of volcanoes.

Heat is not enough to from volcanoes. Other factors are also in play.

5 0
3 years ago
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
Other questions:
  • Sierra did 500 J of work to move her couch. If she exerts 250 N of force on the couch, How fat did she move it? (Work: W = Fd
    15·1 answer
  • Determine the percent composition by mass of the element carbon in the acetamide compound
    12·1 answer
  • Which part of a chemical formula indicates the number of atoms of an element that make up a molecule? A. plus signs B. subscript
    8·2 answers
  • You live 6 kilometers from your school. How many meters do you live from school?
    9·2 answers
  • What is the natural process that converts radiant energy into chemical energy called?
    11·1 answer
  • The standard Gibbs energy of reaction, ÄG°, for the dissociation of phenol is 56.4 kJ mol-1 at 298 K. Calculate the pKa of pheno
    15·1 answer
  • Wind power is:
    13·2 answers
  • A lead mass is heated and placed in a foam cup caloriemeter containing 40.0mL of water at 17.0 C. The water reaches a temperatur
    8·1 answer
  • What is a type of mechanical weathering in which rocks are broken by the expansion of water as it freezes in joints, pores, or b
    10·2 answers
  • Acetylene, C2H2, burns according to the following reaction: C2H2 5O2 --&gt; 4CO2 2H2O. Suppose 1.20 g of C2H2 is mixed with 3.50
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!