1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natalija [7]
4 years ago
9

Which procedure would best allow a scientist to observe a chemical property of hydrochloric acid (HCI) solution?

Chemistry
2 answers:
makkiz [27]4 years ago
6 0
Effervescence of h2 gas will be produced which burns off a glowing split with a pop sound when hcl reacts with a base
ss7ja [257]4 years ago
4 0

Answer:

Adding a piece of Zn

Explanation:

Adding zinc (Zn) to a hydrochloric (HCl) solution will prove its acidity with a redox reaction:

Zn(s) + 2H^+(aq) \longrightarrow Zn^{+2}(aq) + H_2(g)

This reaction can be confirmed,  by the observation of little bubbles in the surface of the metal: that bubbles are the hydrogen gas generated.

You might be interested in
How do atoms form a new substance
LiRa [457]
They split in half making there more atoms
4 0
3 years ago
Read 2 more answers
In which situation would hydrogen bonding be present?
Varvara68 [4.7K]

Answer:

c

Explanation:

hydrogen Bond exist between ammoia, hydrogen fluoride and water so the answer is c

5 0
4 years ago
1. Which of the following facts did Dalton realize?
Ne4ueva [31]
He discovered choice C! this is because atoms of the same element can have different numbers of neutrons
8 0
3 years ago
If a chemist analyzes a 3.84g sample containing sand and table sugar, and recovers 1.43g of      sand, what  percent by mass of
n200080 [17]
We are given with a mixture of sand and table sugar. The mixture has a mas s of 3.84 grams. After recovery, it was found out that there is 1.43 grams of sand. The amount of table sugar then is 3.84-1.43 or 2.41 grams. This is equal to 2.41/3.84 or 62.76% by mass/
4 0
3 years ago
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
Other questions:
  • Which requires more energy to move an electron?
    11·2 answers
  • Classify each substance as a pure substance or a mixture. If it is a pure substance, classify it as an element or a compound. If
    9·2 answers
  • Solve the given problems showing all work for each. 1. Calculate the molar mass/formula mass of ammonium sulfate -- (NH4)2SO4 ,
    6·1 answer
  • When was the element copper discovered? Who discovered the element copper?
    9·2 answers
  • Anyone wanna help? The teacher is making the whole class do an assignment that we can't even do-
    14·2 answers
  • What are the function of a objective lens and the ocular lenses
    12·2 answers
  • How much does 0.0273 moles of Na2O weigh
    5·1 answer
  • A block of iron has a mass of 826 g. What is the volume of the block of iron whose density at 25°C is 7.9
    5·1 answer
  • Balance the Equation <br>with the steps please:)​
    10·2 answers
  • Question progr
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!