1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
s2008m [1.1K]
3 years ago
9

If you are administering an insulin dose of 90.0 mg from a bottle at a concentration of 10.0 mg/mL,

Chemistry
1 answer:
Fiesta28 [93]3 years ago
4 0

Answer:

9 mL.

Explanation:

Dosage of insulin is 90 mg

The concentration of insulin is 10 mg/mL

We need to find how many milliliters of the solution do you need to give the patient. It can be calculated as follows :

x=\dfrac{90\ \text{mg}}{10\dfrac{\text{mg}}{\text{mL}}}\\\\x=\dfrac{9}{1}\ \text{mL}

So, 9 mL of the solution is to be given to the patient.

You might be interested in
Please help!!!!!! Name 3 differences between vascular and non vascular plants
Arlecino [84]
Am letting the picture doing the talk.

8 0
3 years ago
A sample of gold has a mass of 100 grams and a volume of 5cm^3, calculate the density by dividing the mass by volume
Dafna11 [192]

Answer:

20cm^2

Explanation:

Here, Density= Mass/ Volume

=100/5

= 20 cm^2

7 0
3 years ago
Which part of the cell controls many functions of the cell and stores DNA?
kari74 [83]

Answer:

The Nucleus...

it perform many activities and stores DNA in a cell.

6 0
3 years ago
Read 2 more answers
Galena, a mineral of lead, is a compound of the metal with sulfur. Analysis shows that a 2.34-g sample of galena contains 2.03 g
dolphi86 [110]

The mass of sulfur in the sample is 0.31g

To calculate mass of sulfur in sample: given that amount galena is 2.34g and mass of lead is 2.03 g as galena contain both lead and sulfur the mass of sulfur = mass of galena- mass of lead , that is, 2.34- 2.03=0.31g.The molecular mass is a algebraic sum of atomic mass of each element in the compound thus the mass of the compound can be obtained by adding atomic of each element. Lead(II) sulphide occurs naturally as the mineral galena, often known as lead glance (PbS). It is a significant source of silver and the most significant lead ore.

To learn more about mass:

brainly.com/question/19694949

#SPJ4

7 0
2 years ago
The stability of atomic nuclei is related to the
Gekata [30.6K]
Ratio of neutrons & protons .
6 0
3 years ago
Other questions:
  • Lewis dot structure for F2(g)
    7·1 answer
  • What is the ph of a solution with a hydroxyl ion (oh-) concentration of 10-10 m? what is the ph of a solution with a hydroxyl io
    14·2 answers
  • What was the name of the disease that killed nearly half the people of Europe?
    12·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Why is coal not a mineral?
    5·2 answers
  • How many atoms are present in 23.0 g of carbon?
    9·2 answers
  • What is the definition of a solution
    5·1 answer
  • Why is it important to predict consequences when decision-making?
    10·1 answer
  • What forces typically hold ionic solids together?
    5·1 answer
  • Please help picture included 50 points!
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!