1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sphinxa [80]
3 years ago
6

The electron configurations of two unknown elements X and Y are shown . X: 1s^ 2 2s^ 2 2p^ 6 3s^ 1 Y: 1s^ 2 2s^ 1 Which statemen

t is most likely correct about the two elements ?
Chemistry
2 answers:
PIT_PIT [208]3 years ago
8 0

Answer:

See below.

Explanation:

They both have 1 valency electron so will be metallic and in the same Group (Group 1) of the Periodic Table, so will have similar properties.

lozanna [386]3 years ago
7 0

Answer:

This question is incomplete

Explanation:

  • X has an atomic number of 11 and hence it's sodium (Na) while Y has an atomic number of 3 and hence it is Lithium (Li).
  • The atomic mass of X is 23 while that of Y is 7
  • X has three electron shells while Y has two electron shells
  • X and Y cannot form a compound as there ions are both positively charged (cations). However, there ions both have a charge of +1; hence are univalent positive metals.
  • They are both metals and are found in group 1 of the periodic table
  • The are highly reactive metals because they have just one electron in there outermost shell
  • They react with halogens in group 7 to form salts
  • They dissolve in water to form alkaline

You might be interested in
Malonate is a competitive inhibitor of succinate dehydrogenase. If malonate is added to a mitochondrial preparation that is oxid
NARA [144]

Malonate is an aggressive inhibitor of succinate dehydrogenase. If malonate is added to a mitochondrial education this is oxidizing pyruvate as a substrate, it is lower in attention<u> </u><u>Fumarate</u><u>.</u>

<u />

Succinate dehydrogenase is also known as mitochondrial complicated II, and inhibition of succinate dehydrogenase by means of dimethyl malonate has been said to suppress the production of pro-inflammatory cytokines.

Fumaric acid is an organic compound with the system HO₂CCH=CHCO₂H.  It has a fruit-like taste and has been used as a meal additive. . The salts and esters are referred to as fumarates. Fumarate also can consult with the C ₄H ₂O²⁻ ₄ ion.

Learn more about Fumarate here

brainly.com/question/17098570

#SPJ4

<u />

3 0
1 year ago
Read 2 more answers
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
1. A 250g chunk of metal is heated with 400 joules of energy and the temperature goes from 20 °C to 25°C. What is its specific h
Paha777 [63]

The specific heat capacity of this chunk of metal is equal to 0.32 J/g°C.

<u>Given the following data:</u>

  • Mass of metal = 250g
  • Quantity of energy = 400 Joules
  • Initial temperature = 20°C
  • Final temperature = 20°C

To determine the specific heat capacity of this chunk of metal:

<h3>The formula for quantity of heat.</h3>

Mathematically, quantity of heat is given by the formula;

Q = mc\theta

<u>Where:</u>

  • Q represents the quantity of heat.
  • m represents the mass of an object.
  • c represents the specific heat capacity.
  • ∅ represents the change in temperature.

Making c the subject of formula, we have:

c = \frac{Q}{m\theta}

Substituting the given parameters into the formula, we have;

c = \frac{400}{250 \times (25-20)}\\\\c = \frac{400}{250 \times 5}\\\\c = \frac{400}{1250 }

Specific heat, c = 0.32 J/g°C.

Read more on specific heat here: brainly.com/question/2834175

5 0
2 years ago
How many milliliters of a 1.25 molar hydrochloric acid (HCl) solution would be needed to react completely with 60.0 grams of cal
stich3 [128]

<u>Answer:</u>

2400 mL

<u>Explanation:</u>

Ca + 2HCl \implies CaCl_2 + H_2

According to this equation, the stoichiometric ratio between Ca and HCl for the complete reaction is 1:2.

We know that the number of moles of Ca can be calculated using the mole formula. (<em>number of moles = mass / molar mass</em>)

Moles of Calcium = \frac{60}{40} = 1.5 mol

So the moles of HCl = 1.5 \times 2 = 3.0 mol

<em>Volume of HCl solution = Moles of HCl/ concentration of HCl</em>

Volume of HCl solution = \frac{3}{1.25} = 2400 mL

4 0
3 years ago
In determining nuclear binding energy, what is Einstein's equation used to do?
natita [175]
Basically this is used in calculating the nuclear binding energy by converting the mass defect (calculated first) to energy and if we recall, Einstein's equation E=mc2 is the perfection equation to use because E=mc2 in which E represents units of energy, m represents units of mass, and c 2 is the speed of light squared. 
3 0
3 years ago
Other questions:
  • Disccuss what happens to copper in photochromic lenses from a redox perspective.
    8·1 answer
  • Which one of the following statements best describes the particles in a gas?
    12·1 answer
  • Why is the formula for sodium thiosulfate Na2S2O3, not Na2SO3?
    9·1 answer
  • The molecular formula mass of this compound is 150 amu . what are the subscripts in the actual molecular formula? enter the subs
    11·1 answer
  • Which of the following is not a base <br> a)orange <br> b)shampoo <br> c)toothpaste <br> c)bleach
    7·2 answers
  • A cylindrical object has a diameter of 1.25 cm and a height of 6.48 cm. what is its volume?
    5·1 answer
  • What’s the equation to solid calcium oxide reacts with hydrochloric acid to form a solution of calcium chloride and water as it’
    6·1 answer
  • When H2SO4 is added to PbI2, a precipitate of PbSO4 forms. The PbSO4 is then filtered from the solution, dried, and weighed. If
    6·1 answer
  • What reasons might there be for the oil boiling slower than the other substances, besides forces between molecules?
    13·2 answers
  • Does a negative ΔH mean that the heat should be treated as a reactant or as a product?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!