1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mariana [72]
3 years ago
5

Which of the following types of molecules always has a dipole moment? Linear molecules with two identical bonds. Trigonal pyrami

d molecules (three identical bonds). Trigonal planar molecules (three identical bonds equally spaced). Tetrahedral molecules (four identical bonds equally spaced). None has a dipole moment.
Chemistry
1 answer:
natali 33 [55]3 years ago
8 0

Answer:

Trigonal pyramid molecules (three identical bonds)

Explanation:

In trigonal pyramidal molecule  like molecule of ammonia , the vector some of intra- molecular dipole moment is not zero because the bonds are not symmetrically oriented . In other molecules , bonds are symmetrically oriented in space so the vector sum of all the internal dipole moment  vectors cancel each other to make total dipole moment zero.

You might be interested in
What is/are one of the environmental waste products of nuclear energy?
Alenkinab [10]

D. radioactive isotopes are one of the environmental waste products of nuclear energy.

4 0
3 years ago
Read 2 more answers
Your lab partner turns to get a pencil, and accidentally knocks over and breaks a test tube full of sulfuric acid. What should y
Troyanec [42]
The answer to your question is D. hope this helps
-dabs-

4 0
3 years ago
Read 2 more answers
Should I use flex seal to clean a baby
shusha [124]
After 2 hours of research and calculations, the answer is E: Pepsi is bootleg
8 0
2 years ago
What is the oxidation number of iodine in KL04?<br> (1)- +1<br> (2)- -1<br> (3)- +7<br> (4)- -7
Nostrana [21]
3) +7

I got this stupid question wrong so that you people don't have to. I simply hate chemistry and I wish it didn't exist. Kind of like this website that makes me explain the answer. 

Trust me, the answer is correct
4 0
3 years ago
Please help me with my homework thanks
choli [55]

Answer:

electrons are transferred from the clouds to the grounf

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • What type of substance reacts with limestone (CaCO3) and produces carbon dioxide gas?
    5·2 answers
  • Which group of extremophiles does thermus aquaticus belong to
    6·2 answers
  • A baseline for an experimental investigation is provided by the
    11·2 answers
  • Water is being pumped from the bottom of a well 150 feet deep at a rate of 200 gal/hour into a vented storage tank 30 feet above
    7·1 answer
  • Gay-Lussac's law states:
    11·1 answer
  • This particle determines what element you have - the element's identity.
    10·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • List three limitations of human space travel
    7·2 answers
  • Why is the absolute dating of rocks important?
    14·1 answer
  • A The birthrate is higher than the death rate.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!