1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexandr402 [8]
3 years ago
6

The taste of acid is sour​

Chemistry
2 answers:
arlik [135]3 years ago
7 0

Answer:

have you tasted acid?

Explanation:

also the taste of salt is sour.

yulyashka [42]3 years ago
4 0
... why would you taste acid
You might be interested in
What is Displacement reaction . Explain with an example.​
jok3333 [9.3K]

Explanation:

A displacement reaction is the one wherein the atom or a set of atoms is displaced by another atom in a molecule. For instance, when iron is added to a copper sulphate solution, it displaces the copper metal. A + B-C → A-C + B.

6 0
2 years ago
Please help me, please i really need it :)
Mekhanik [1.2K]

GGCCATAGGTCCCTTTAGCG

I believe this is correct (I used the complementary base)

4 0
3 years ago
A reaction mechanism is defined as the sequence of reaction steps that define the pathway from reactants to products. Each step
olga55 [171]

Answer: (a) K *[A][B]^2

(b) The answer is B

Explanation:

A)

Step1:A+B<--> C (fast)

Step2: B+C→D(slow)

Rate depends on slowest step.

so,

rate = k' [B][C] ...eqn 1

But C is intermediate.so use step 1

Since 1st step is an equilibrium,

Kc = [C] /[A][B]

so,

[C] = Kc [A][B] ...eqn 2

put eqn 2 in eqn 1

rate = k' *[B] * Kc [A][B]

= k'Kc*[A][B]^2

= K *[A][B]^2 {writing k'Kc = K}

Answer: K *[A][B]^2

B)

Answer is B

Since rate depends on slowest step.

if slowest step is:

X2Y2+Z2→X2Y2Z+Z

then only,

rate= k[X2Y2][Z2]

Answer: B

6 0
3 years ago
Inside the room the air is often warmer near the ceiling than near the floor. Which of the following accounts for the difference
Rudiy27
The correct answer would be C. Convection, which describes that heat rises.
3 0
3 years ago
How are the geographical equator, meteorological equator, and ITCZ related? What happens at the ITCZ?
scoray [572]
The ITCZ<span> or </span>Intertropical Convergence Zone<span> is a region on Earth that experiences ... The </span>ITCZ<span> lies near the </span>equator<span>, bringing precipitation caused by convection. ... </span>Related<span>. The Poetry of Sailors: What Are Doldrums and Trade Winds</span>
4 0
3 years ago
Other questions:
  • The interior of a refrigerator has a volume of 0.600 m3. the temperature inside the refrigerator in 282 k, and the pressure is 1
    11·1 answer
  • Is it true that you get density by dividing mass by volume? And which one in the picture is denser?
    9·1 answer
  • A car rolls down a ramp. What is the force acting on the car that causes the movement down the ramp? A) acceleration B) centripe
    11·1 answer
  • What is the definition of a covalent bond?
    11·2 answers
  • Which of the following best describes the difference between a scientific theory and a scientific law?
    15·1 answer
  • I don't understand this part? Plz help =)
    8·1 answer
  • can someone please help me with this question, it's for my lab report. I tried my best but failed to do the calculation. please
    14·1 answer
  • How does the plasma membrane contribute to the structure and function of the cell?
    9·2 answers
  • What are phrases that you need to include in your TCT that show that you are citing evidence? Failure to use these phrases will
    8·1 answer
  • Of the following substances, an aqueous solution of ________ will form basic solutions. nh4cl cu(no3)2 k2co3 naf a) k2co3, nh4cl
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!