1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natali5045456 [20]
3 years ago
6

On one side of the cycle, green plants take in carbon atoms from the air make them part of their______

Chemistry
1 answer:
alexandr402 [8]3 years ago
6 0
The answer is Glucose - Sugar
You might be interested in
If a neutral atom of chlorine has 17 electrons and 18 neutrons, how many protons does it have?
IceJOKER [234]
17, to be neutral it has to have equal number of protons and electrons
7 0
4 years ago
Read 2 more answers
To what is wax susceptible
maks197457 [2]
Wax is definitely susceptible to heat and with the application of heat such as burning a candle, the solid wax gets converted into a liquid. This fact can be used to remove ear wax also actually using hollow candles that will melt the ear wax and allow it to be drained out of the ear. 
4 0
3 years ago
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
In a heterogeneous mixture the materials are mixed together and
Arisa [49]
In a heterogeneous mixture the materials are mixed together and will be easily separated. The correct option among all the options that are given in the question is the second option or option "b". An example of a heterogeneous mixture is a bowl of colored candies. I hope the answer helps you.
5 0
4 years ago
On the moon the acceleration due to gravity is 1.6 ms if an object has a mass on earth of 5.1kg what is its mass on the moon
Y_Kistochka [10]

Answer:

Mass on the moon is 5.1 kg.

Explanation:

Given mass on earth = 5.1 kg

acceleration due to gravity on moon = 1.6 ms⁻².

The mass on the moon does not change because mass is the quantity of matter in the body regardless of its volume or  of any forces acting on it.

Whereas the weight of the object changed.

Weight is the the force exerted on a body which is related to mass and expressed as W = mg.

W = weight of object   m = mass of object      and g = gravitational force

So\ in\ this\ case\ W\ =1.6\times\ 5.1\ =8.16N

N stands for newton unit of weight.

Thus mass of the object on moon is same as on earth which is 5.1 kg.

3 0
3 years ago
Other questions:
  • What is a substance?
    10·2 answers
  • What is the measure of angle QCR?
    5·2 answers
  • A gamma ray primarily consists of pure energy and no mass. TRUE or FALSE
    9·2 answers
  • The ksp of pbi2 is 1.4 x 10-8. what is the molar solubility of lead(ii iodide in a solution of 0.400 m sodium iodide?
    13·1 answer
  • A reaction produces 0.755 mol of H2O. How many molecules of water are produced?
    6·1 answer
  • What is the concentration of a solution with a volume of 2.5 liters containing 600 grams of calcium phosphate?​
    8·1 answer
  • What's the charge on Ni in the compound NiCi3? *
    12·1 answer
  • What is the advantage of seeds that can be spread over a wide area?
    13·1 answer
  • Can you guys help me with this one part?
    14·2 answers
  • Use the image above and describe the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!