1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Misha Larkins [42]
3 years ago
12

What type of reaction is shown below?

Chemistry
1 answer:
natima [27]3 years ago
8 0
An exothermic reaction is a type of chemical reaction in which energy is released to the environment in form of heat or light. Endothermic reaction in the other hand is a chemical reaction where energy is taken from the surroundings and thus the surroundings end up with less energy than they started with. In this case; the above reaction is an Exothermic reaction (heat is being released to the surroundings).
You might be interested in
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
2 years ago
If I mix two chemicals in a test tube and notice after a few seconds that there are ice crystals forming on the outside of the t
miss Akunina [59]

Answer:

endothermic reaction

Explanation:

It simply means that you are witnessing<u> an endothermic reaction</u>.

An endothermic reaction is one that absorbs heat energy from its surrounding, thereby leaving the reaction vessel with a lower temperature as compared to before the reaction.

It is as opposed to exothermic reactions which are reactions that give off energy in the form of heat to the surrounding, thereby leaving a reaction vessel warmer than before the reaction.

<em>In this case, the formation of ice crystals outside the test tube means that heat energy has been absorbed by the reaction which leaves the vessel a temperature cold enough to activate the formation of ice. </em>

5 0
2 years ago
Suidtkdrididididkxkdkdkdfkgjfjffj
tatyana61 [14]
Its random, with no sense of meaning to it. Besides a person just typing things

7 0
3 years ago
How many calories are required to boil 75 grams of water not in sig figs
Norma-Jean [14]

Well, each ml of water requires one calorie to go up 1 degree Celsius, so this liter of water takes 1000 calories to go up 1 degree Celsius. (There are 1000 ml, each of which needs to have its temperature raised.)

3 0
2 years ago
In the winter, a heated home in the Northeast might be maintained at a temperature of 78°F. What is this temperature on the Cels
masya89 [10]

Answer:  25.6^0C,  298.6K

Explanation:

Temperature of the gas is defined as the degree of hotness or coldness of a body. It is expressed in units like ^0C and K  

These units of temperature are inter convertible.

We are given:

Temperature of the gas = 78^0F

Converting this unit of temperature into ^0C by using conversion factor:

^oC=\frac{5}{9}\times (^oF-32)

^0C=\frac{5}{9}\times (78^oF-32)

25.6^0C

Converting this unit of temperature into K by using conversion factor:

K=t^0C+273

K=25.6+273

298.6K

Thus the temperature on the Celsius and Kelvin scales are 25.6^0C  and 298.6K respectively.

6 0
3 years ago
Other questions:
  • A sample of Freon-12 (CF2Cl2) occupies 25.5 L at 298 K and 153.3 kPa. Find its volume at STP.
    9·1 answer
  • What is the density of 19 milliliters of a liquid substance with a mass of 6.05 grams?<br>​
    8·1 answer
  • Applying Gas Laws to Hot Air Balloons
    8·1 answer
  • A solution with the concentration of 0.15 M is made using 8.00 grams of K2CrO4. How many milliliters of H2O should be used?
    6·1 answer
  • Density is calculated by solving for a mass divided by ______
    6·1 answer
  • Calculate the kelvin scale equivalent of 123 Celsius?
    7·1 answer
  • What are the lewis structures for [SrCN]-
    12·1 answer
  • (Forensics)Quick!! Can someone write me a story on a blood spatter crime scene i can use? Story needs to be descriptive &amp; co
    5·1 answer
  • The pressure of a sample of gas is measured at sea level with an open-end mercury manometer, and the liquid level is 13.7 cm hig
    15·1 answer
  • Which of the following is the best way to
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!