1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yanka [14]
4 years ago
15

The table shows the number of reactants and products present during two separate chemical reactions.

Chemistry
1 answer:
aleksandr82 [10.1K]4 years ago
6 0

Answer: Option (a) is the correct answer.

Explanation:

A decomposition reaction is defined as a reaction where a compound dissociates into two or more atoms.

For example, A \rightarrow B + C + D

Whereas a chemical reaction in which two reactants combine together to result in the formation of a compound is known as a synthesis reaction.

For example, A + B \rightarrow C is a synthesis reaction.

Thus, we can conclude that the statement chemical reaction A, because the reactant is a compound identifies the decomposition reaction and describes a substance is involved.

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
6th grade science i mark as brainliest​
Blababa [14]

Answer:

It's the 4th one. The car is accelerating gradually.

8 0
3 years ago
Dimethyl sulfide is the most abundant biological sulfur compound emitted to the atmosphere. It is produced by phytoplankton and
iogann1982 [59]

The structure of Dimethyl sulfide is H3C-S-CH3. It is produced naturally by some marine algae.

<u>Explanation:</u>

  • DMS or dimethyl sulfide is formed by using two methyl groups combined with one sulfur atom. It is an organosulphur compound with a structural formula H3C-S-CH3.
  • Most abundant biological sulfur compounds emitted to air and oceans by phytoplankton.
  • DMS is produced naturally by the waste of dimethyl sulphoxide which is disposed into the sewer causing environmental odor problems.
  • It is a flammable liquid that boils at 37 degrees celsius and a disagreeable smell produced from the cooking of certain vegetables also indicates bacterial contamination in the production of malt and brewing.

6 0
3 years ago
What is the negatively charged sub-atomic particle of an atom?
vitfil [10]
C electron. Electrons have a negative charge!
7 0
3 years ago
Read 2 more answers
If sodium arsenite is Na3AsO3, the formula for calcium arsenite would be
lara31 [8.8K]

Answer:

Ca₃(AsO₃)₂

Explanation:

Sodium arsenite, with the chemical formula Na₃AsO₃, is formed  by the cation Na⁺ and the anion AsO₃³⁻. For the molecule to be neutral, 3 cations Na⁺ and 1 anion AsO₃³⁻ are required.

Calcium arsenite would be formed by the cation Ca²⁺ and the anion AsO₃³⁻. For the molecule to be neutral, we require 3 cations Ca²⁺ and 2 anions AsO₃³⁻. The resulting chemical formula is Ca₃(AsO₃)₂.

4 0
3 years ago
Other questions:
  • How will carbon behave at room temperature?
    9·1 answer
  • In general, the solubility of ________ in water decreases as temperature increases.
    7·2 answers
  • Which word equation shows hydrogen reacting with oxygen to form water?
    6·1 answer
  • Is the autoionization of water endothermic or exothermic?
    5·1 answer
  • What is a key factor in the rate of chemical weathering of rock? The size of the rocks Chemical composition Exposure to wind
    6·1 answer
  • K₂O +2Li Li₂O +2k how do you solve?
    12·1 answer
  • I need help please &lt;33
    14·1 answer
  • Study the image. Warm and cold air fronts with points labeled 1 through 4. 1: cold air entering from the left and moving down. 2
    14·2 answers
  • How do covalent bonds form neutral compounds?
    9·1 answer
  • Given his arrangement of the periodic table, Mendeleev was able to predict three elements that had not yet been discovered. He p
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!