1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ahrayia [7]
3 years ago
15

For the reaction 2Fe + 3Cl2 → 2FeCl3 which of the following options gives the correct reactant:reactant ratio?

Chemistry
2 answers:
katovenus [111]3 years ago
5 0

Answer: The correct answer is Option 2.

Explanation:

For the given reaction:

2Fe(s)+3Cl_2(g)\rightarrow 2FeCl_3(s)

By Stoichiometry of the reaction:

2 moles of iron reacts with 3 moles of chlorine gas to produce 2 moles of iron chloride.

The stoichiometric coefficient of iron = 2

The stoichiometric coefficient of chlorine = 3

Mole ratio of Iron : Chlorine = Stoichiometric coefficient of Iron : Chlorine = 2 : 3

Hence, the correct answer is Option 2.

fredd [130]3 years ago
3 0
Fe:Cl2 = 2:3

You just use the subscripts.
You might be interested in
Which of the following is NOT a chemical reaction?
Damm [24]
Ice melting from water. Nothing has changed except the state of matter.
6 0
3 years ago
Describe the differences between bonding in an ionic compound and bonding in a covalent molecule.
Fudgin [204]

a covalent bond and an ionic bond. An ionic bond if formed from the transfer of electrons from the outer shell of atoms. ... An example of this is NaCl, where the sodium atom becomes Na+ due to the loss of electrons, and the chlorine atom becomes the negatively charged chloride (Cl-).

8 0
3 years ago
Igneous rocks would most likely be found near:
geniusboy [140]

Answer:

the deep sea floor. Known as the oceanic crust.

Explanation:

The deep seafloor (the oceanic crust) is made almost entirely of basaltic rocks, with peridotite underneath in the mantle. Basalts are also erupted above the Earth's great subduction zones, either in volcanic island arcs or along the edges of continents.

Hope this helps :)

7 0
3 years ago
Determine the basic oxidation<br>number for elements in s and p<br>orbitals​
Andrews [41]

Answer:

Explanation:

The oxidation state, sometimes referred to as oxidation number, describes the degree of oxidation (loss of electrons) of an atom in a chemical compound. Conceptually, the oxidation state, which may be positive, negative or zero, is the hypothetical charge that an atom would have if all bonds to atoms of different elements were 100% ionic, with no covalent component. This is never exactly true for real bonds.

The term oxidation was first used by Antoine Lavoisier to signify reaction of a substance with oxygen. Much later, it was realized that the substance, upon being oxidized, loses electrons, and the meaning was extended to include other reactions in which electrons are lost, regardless of whether oxygen was involved.

Helped?

Brainliest?

7 0
3 years ago
G.com what is the mass of a gold bar that is 7.379 × 10–4 m3 in volume
tiny-mole [99]
<span>7.379 * 10^(-4) is measured, hence prone to error, either human error or via measuring device. In this case,
100 cm = 1 m is written in stone and is unquestionable.
 The density of the gold is 19.3 g/cm^3 and could be an approximation.
 The approximation is good to at least one night.</span>
5 0
3 years ago
Other questions:
  • What are the uses of zinc
    12·2 answers
  • el nitrogeno es un gas que se utiliza para conservar embriones,su temperatura es de -195,8ºc calcula esta temperatura en K y ºF
    6·1 answer
  • How much sodium nitrate is in a hotdog?​
    7·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • how much water must be added when 125 mL of a 2.00 M solution of HCl is diluted to a final concentration of 0.400M?
    8·2 answers
  • What is the theoretical yield of methanol (ch3oh) when 12.0 grams of h2 is mixed with 74.5 grams of co? co 2h2 ch3oh
    6·2 answers
  • A student develops the list shown below that includes laboratory equipment and materials for constructing a voltaic cell.
    6·1 answer
  • If 0.400 moles CO and 0.400 moles O2 completely react how many grams of CO2 are produces?
    5·1 answer
  • 20. 6th-grade question
    6·1 answer
  • Uranium and radium are found in many rocky soils throughout the world. Both undergo radioactive decay, and one of the products i
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!