1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Iteru [2.4K]
3 years ago
7

Three 5-l flasks, fixed with pressure gauges and small valves, each contains 4 g of gas at 273 k. flask a contains h2, flask b c

ontains he, and flask c contains ch4. rank the flask contents in terms of

Chemistry
1 answer:
Varvara68 [4.7K]3 years ago
7 0
First, please check the missing part in your question in the attachment.
a) So first, the Rank of pressure:
according to this formula PV = nRT and when n = m/Mw
PV = m/Mw * R*T
when we have the same mass m and the same V volume so P will proportional with the mole weight M as when the M is smaller the pressure will be greater 
when Mw of H2(A) = 2 g / Mw of He (B) = 4 g and Mw of CH4(C) = 16 g
∴ Pressure :
 (A) > (B) > (c)

B) The rank of average molecular kinetic energy:
when K = 3/2 KB T
when K is the average kinetic energy per molecule of gas 
and KB is Boltzmann's constant
and T is the temperature (K)
So from this equation, we can know that K only depends on T value, and when we have the T constant here for A, B, and C So the rank of K will be like the following:
∴ A = B = C
C) the rank of diffusion rate after the valve is opened:
according to this formula:
R2/R1 = √M1/M2
from this equation, we can see that diffusion is proportional to the reciprocal of the molecular mass M so,
when Mw H2 (A) = 2 g & Mw He(B) = 4 g & CH4 (C) = 16 g
∴ the rank of diffusion:
A > B > C

D) The rank of the Total kinetic energy of the molecules:
when we have the Mw different so it will make the no.of molecules differs as when the Mw is low the no.of molecules will be hight, and when the average molecular kinetic energy equals. so the total kinetic energy will depend on no. of molecules 
∵ Mw A < Mw B < Mw C 
∴no .of molecules of A > B >C
∴ the rank of total kinetic energy is:
A > B > C

e) the rank of density:

when ρ = m/ v 
and m is the mass & v is the volume and we have both is the same for A, B, and C
so the density also will be the same, ∴ the rank of the density is:
A = B = C

F) the rank of the collision frequency:
as the no.of molecules increase the collision frequency increase and depend also on the velocity and it's here the same.
∴ Collision frequency will only depend on the no.of molecules
we have no.of molecules of A > B > C as Mw A < B < C 
∴the rank of the collision frequency is:
A > B > C 

 



You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Magnesium chloride is a salt formed with ionic bonds between one magnesium ion and two chloride ions. Magnesium has two electron
katrin [286]

Answer:

The magnesium atom loses 2 electron to the 2 atoms of chlorine. The 7 valency electrons of each chlorine atom will now be 8 to attain stable configuration. The final compound is written as MgCl2.

Explanation:

Ionic compounds are compound formed from the transfer of electron(s). One atom of the element loses electron(s) while the other atom gains electron(s).

The compound Magnesium chloride is an ionic compound . The bond between an atom of magnesium and 2 atoms of chlorine is an ionic bonding.

The valency electron of magnesium is 2 electron , for the atom of magnesium to  attain octet rule, it will easily lose it 2 electrons to the chlorine atoms.

The chlorine atom on the other hand has 7 valency electrons, to attain octet configuration it will most likely gain 1 electron to become stable.

The magnesium atom loses 2 electron to the 2 atoms of chlorine. The 7 valency electrons of each chlorine atom will now be 8 to attain stable configuration. The final compound is written as MgCl2.

7 0
3 years ago
Write your name on a piece of paper with a water soluble marker and place the slime on top of it and remove very quickly before
creativ13 [48]
Uh i did this because it made me curious... i may have done it wrong nothing happened
3 0
3 years ago
Write the equation for the formation of water gas
GREYUIT [131]

Answer:

the answer is C + H2O # CO + H2.

4 0
3 years ago
Read 2 more answers
if 28.5 g of calcium hydroxide is dissolved in enough water to make 185g of solution what is the percent by mass of calcium hydr
DENIUS [597]

The percent by mass of calcium hydroxide in the solution : 15.41%

<h3>Further explanation</h3>

The concentration of a substance can be expressed in several quantities such as moles, percent (%) weight/volume,), molarity, molality, parts per million (ppm) or mole fraction. The concentration shows the amount of solute in a unit of the amount of solvent.

Mass of solute (Ca(OH₂-Calcium hydroxide) : 28.5

Mass of solution = 185 g

\tt \%mass=\dfrac{mass~solute}{mass~solution}\times 100\%\\\\\%mass=\dfrac{28.5~g}{185~g}\times 100\%\\\\\%mass=15.41\%

6 0
3 years ago
Other questions:
  • What are the reactants in the following chemical equation: Zn + CuSO4 -----&gt; ZnSO4 + Cu
    6·1 answer
  • Alcohol and water have different boiling points. Which method would you use to separate them
    5·2 answers
  • A microscope containing two or more lenses is an
    6·1 answer
  • How to solve the number of mol​
    8·1 answer
  • What is the relationship between urbanization and population increase
    8·1 answer
  • If an unknown liquid has a density of 0.756 g/mL and a mass of 2.00 g, what is its volume?
    14·1 answer
  • Im so alone and i really need friends and maybe more pls dont delete my quiestion
    13·1 answer
  • Which of the following involves a chemical change?
    11·2 answers
  • How’s life going<br> Yes I would like to know<br> No guys this is not for school
    15·2 answers
  • What is simple distllation​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!