Answer:
what would the question be?
Answer:
0.0184
Explanation:
Let's consider the following reaction at equilibrium.
2 HI(g) ⇌ H₂(g) + I₂(g)
The concentration equilibrium constant (Kc) is equal to the product of the concentration of the products raised to their stoichiometric coefficients divided by the product of the concentration of the reactants raised to their stoichiometric coefficients.
Kc = [H₂] × [I₂] / [HI]²
Kc = (4.78 × 10⁻⁴) × (4.78 × 10⁻⁴) / (3.52 × 10⁻³)²
Kc = 0.0184
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Explanation:
Higher the frequency smaller will be the wavelength. Higher frequency have shorter wavelength and lower frequency waves have larger wavelength. Also, Beats are formed by the superposition of two waves with slightly different frequencies but with similar amplitudes. In time, waves switch between constructive interference and disruptive interference, giving the resultant wave a time-varying amplitude.
Answer:
sorry but i am doing this for point
Explanation:
how do I complete this column graph of the number of conduct vs the number of
