1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aniked [119]
3 years ago
13

Sound wave a has lower frequency than sounds wave b but both waves have the same amplitude . What must also be true of these two

waves ?
Chemistry
2 answers:
Nady [450]3 years ago
8 0

Explanation:

Higher the frequency smaller will be the wavelength. Higher frequency have shorter wavelength and lower frequency waves have larger wavelength. Also, Beats are formed by the superposition of two waves with slightly different frequencies but with similar amplitudes. In time, waves switch between constructive interference and disruptive interference, giving the resultant wave a time-varying amplitude.

alina1380 [7]3 years ago
4 0

Answer:

Wave A has a lower pitch

Explanation:

I got it right

You might be interested in
Insertion mutation definition ?
blondinia [14]

Answer:

Insertion is a type of mutation involving the addition of genetic material. An insertion mutation can be small, involving a single extra DNA base pair, or large, involving a piece of a chromosome.

Explanation:

4 0
3 years ago
Read 2 more answers
We can separate sand from water by using a cloth or filter paper , but we .cannot separate salt from water by the same method.
Nataly_w [17]
Yeh yeh


Yeh sepsreat water lawl
6 0
2 years ago
Read 2 more answers
What is true of a gas
velikii [3]

Answer:

did you have options, cause if you did chose something alond the lines of

Explanation:

A real gas is a gas that does not behave as an ideal gas due to interactions between gas molecules. A real gas is also known as a nonideal gas because the behavior of a real gas in only approximated by the ideal gas law.

3 0
3 years ago
A photon has a wavelength of 750 no. What is the energy in joules
zhuklara [117]

Answer:

750

Explanation:

750

8 0
3 years ago
How many molecules are in 41.8 g of sulfuric acid
Anton [14]

Answer

× 10²³ molecules are in 41.8 g of sulfuric acid

Explanation

The first step is to convert 41.8 g of sulfuric acid to moles by dividing the mass of sulfuric acid by its molar mass.

Molar mass of sulfuric acid, H₂SO₄ = 98.079 g/mol

Mole=\frac{Mass}{Molar\text{ }mass}=\frac{41.8\text{ }g}{98.079\text{ }g\text{/}mol}=0.426187053\text{ }mol

Finally, convert the moles of sulfuric acid to molecules using Avogadro's number.

Conversion factor: 1 mole of any substance = 6.022 × 10²³ molecules.

Therefore, 0.426187053 moles of sulfuric acid is equal

\frac{0.426187053\text{ }mol}{1\text{ }mol}\times6.022×10²³\text{ }molecules=2.57\times10^{23}\text{ }molecules

Thus, 2.57 × 10²³ molecules are in 41.8 g of sulfuric acid.

3 0
1 year ago
Other questions:
  • What makes metalloids a group of their own?
    12·2 answers
  • The table below shows the dimensions of two colored cubes. Dimensions of Cubes
    5·2 answers
  • What Is the name of the force that holds together the sub Tomic particles of the nuclear?
    10·1 answer
  • List three particals that make up atoms
    9·1 answer
  • a cork is able to float on water because it is A: a crystalline sold B: equal density to water C: small in size D:less dense tha
    11·2 answers
  • Select the single best answer. Consider the following half-reactions: MnO4−(aq) + 8H+(aq) + 5e−→ Mn2+(aq) + 4H2O(l) NO3−(aq) + 4
    7·1 answer
  • As current flows through a system, what happens to the voltage available at each load?
    9·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Exhibits the highest intermolecular<br> forces of the states of matter.
    11·1 answer
  • Which energy changes would take place when a water is heated using a Bunsen burner?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!