1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Softa [21]
3 years ago
14

When aluminum is placed in concentrated hydrochloric acid, hydrogen gas is produced. 2 Al ( s ) + 6 HCl ( aq ) ⟶ 2AlCl3 ( aq ) +

3 H 2 ( g ) What volume of H 2 ( g ) is produced when 8.60 g Al ( s ) reacts at STP
Chemistry
1 answer:
Rufina [12.5K]3 years ago
6 0

Answer:

The answer to your question is  V = 19.9 L

Explanation:

Data

mass of Al = 8.60 g

volume of H₂ = ?

Balanced chemical reaction

                 2Al  +  6HCl  ⇒   2AlCl₃  +  3H₂

1.- Use proportions to calculate the mass of H₂ produced

Atomic mass of Al = 2 x 27 = 54 g

Atomic mass of H₂ = 6 x 1 = 6 g

                54 g of Al -------------------- 6 g of H₂

                  8 g  of Al -------------------  x

                  x = (8 x 6) / 54

                  x = 48 / 54

                  x = 0.89 g of H₂

2.- Calculate the volume of H₂

- Convert the H₂ to moles

                    1 g of H₂ --------------- 1 mol

                   0.89 g    ---------------- x

                    x = 0.89 moles

                    1 mol of H₂ -------------- 22.4 l

                   0.89 moles  ------------- x

                    x = (0.89 x 22.4) / 1

                   x = 19.9 L                        

You might be interested in
The average atomic masses of some elements may vary, depending upon the sources of their ores. Naturally occurring boron consist
frez [133]
Sorry I don’t know but good luck!
6 0
3 years ago
Read 2 more answers
What determines the amount of chemical energy a substance has. 6th grade level please
Galina-37 [17]
<span>The thermodynamic determines the amount of chemical energy a substance has.</span>
3 0
3 years ago
How many liters of hydrogen gas will be produced at STP from the reaction of 7.179×10^23 atoms of magnesium with 54.219g of phos
Alexeev081 [22]

Answer: The volume of hydrogen gas produced will be, 12.4 L

Explanation : Given,

Mass of H_3PO_4 = 54.219 g

Number of atoms of Mg = 7.179\times 10^{23}

Molar mass of H_3PO_4 = 98 g/mol

First we have to calculate the moles of H_3PO_4 and Mg.

\text{Moles of }H_3PO_4=\frac{\text{Given mass }H_3PO_4}{\text{Molar mass }H_3PO_4}

\text{Moles of }H_3PO_4=\frac{54.219g}{98g/mol}=0.553mol

and,

\text{Moles of }Mg=\frac{7.179\times 10^{23}}{6.022\times 10^{23}}=1.19mol

Now we have to calculate the limiting and excess reagent.

The balanced chemical equation is:

3Mg+2H_3PO_4\rightarrow Mg(PO_4)_2+3H_2

From the balanced reaction we conclude that

As, 3 mole of Mg react with 2 mole of H_3PO_4

So, 0.553 moles of Mg react with \frac{2}{3}\times 0.553=0.369 moles of H_3PO_4

From this we conclude that, H_3PO_4 is an excess reagent because the given moles are greater than the required moles and Mg is a limiting reagent and it limits the formation of product.

Now we have to calculate the moles of H_2

From the reaction, we conclude that

As, 3 mole of Mg react to give 3 mole of H_2

So, 0.553 mole of Mg react to give 0.553 mole of H_2

Now we have to calculate the volume of H_2  gas at STP.

As we know that, 1 mole of substance occupies 22.4 L volume of gas.

As, 1 mole of hydrogen gas occupies 22.4 L volume of hydrogen gas

So, 0.553 mole of hydrogen gas occupies 0.553\times 22.4=12.4L volume of hydrogen gas

Therefore, the volume of hydrogen gas produced will be, 12.4 L

4 0
3 years ago
7.00 of Compound x with molecular formula C3H4 are burned in a constant-pressure calorimeter containing 35.00kg of water at 25c.
beks73 [17]

Answer:

\Delta H_{f,C_3H_4}=276.8kJ/mol

Explanation:

Hello!

In this case, since the equation we use to model the heat exchange into the calorimeter and compute the heat of reaction is:

\Delta H_{rxn} =- m_wC_w\Delta T

We plug in the mass of water, temperature change and specific heat to obtain:

\Delta H_{rxn} =- (35000g)(4.184\frac{J}{g\°C} )(2.316\°C)\\\\\Delta H_{rxn}=-339.16kJ

Now, this enthalpy of reaction corresponds to the combustion of propyne:

C_3H_4+4O_2\rightarrow 3CO_2+2H_2O

Whose enthalpy change involves the enthalpies of formation of propyne, carbon dioxide and water, considering that of propyne is the target:

\Delta H_{rxn}=3\Delta H_{f,CO_2}+2\Delta H_{f,H_2O}-\Delta H_{f,C_3H_4}

However, the enthalpy of reaction should be expressed in kJ per moles of C3H4, so we divide by the appropriate moles in 7.00 g of this compound:

\Delta H_{rxn} =-339.16kJ*\frac{1}{7.00g}*\frac{40.06g}{1mol}=-1940.9kJ/mol

Now, we solve for the enthalpy of formation of C3H4 as shown below:

\Delta H_{f,C_3H_4}=3\Delta H_{f,CO_2}+2\Delta H_{f,H_2O}-\Delta H_{rxn}

So we plug in to obtain (enthalpies of formation of CO2 and H2O are found on NIST data base):

\Delta H_{f,C_3H_4}=3(-393.5kJ/mol)+2(-241.8kJ/mol)-(-1940.9kJ/mol)\\\\\Delta H_{f,C_3H_4}=276.8kJ/mol

Best regards!

7 0
3 years ago
Pls somebody help me with this question! <br> The pictures have to be in order!
irina1246 [14]

Answer:

I believe the organelle should replace the question mark!

3 0
2 years ago
Read 2 more answers
Other questions:
  • TRUE or FALSE: The charge of an atom (ion) is determined by the ratio of electrons to protons.
    7·2 answers
  • Calculate the number of atoms of bromine in 1.37 g of bromine. Give your answer in scientific notation. Enter your answer in the
    8·1 answer
  • Chemical and physical properties for Benzoyl peroxide?
    11·1 answer
  • A compound contains 74.2 g Na and 25.8 g O. Determine the Empirical Formula for this compound
    9·2 answers
  • Como se representan los elementos en la tabla¿?
    10·1 answer
  • 0. When measuring tert-butyl alcohol for this experiment, a student first weighs an empty graduated cylinder, then pours 15 mL o
    14·1 answer
  • Please help 10 points asap​
    11·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Potrzebuje pomocy pilnie!! daję naj
    14·1 answer
  • What was the biggest challenge you faced in getting to where you are today and how did you overcome it?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!