1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
agasfer [191]
2 years ago
14

0. When measuring tert-butyl alcohol for this experiment, a student first weighs an empty graduated cylinder, then pours 15 mL o

f the alcohol into the graduated cylinder and weighs the cylinder again. He records the amount of alcohol used as the difference in these two masses. What is wrong with this method
Chemistry
1 answer:
lozanna [386]2 years ago
6 0

Answer:

Both have solutions in the  graduated cylinder.

Explanation:

Recording the amount of alcohol used as the difference between two masses is the wrong method used for measuring tert-butyl alcohol for the experiment.  For measuring tert-butyl alcohol for this experiment, the student has to measure the two masses when both the graduated cylinders has solution of tert-butyl alcohol not when one of it is empty (having no tert-butyl alcohol ).

You might be interested in
Jim, Jill, Robert, and Kim each run paper chromatography on an unknown aqueous mixture. Jim gets a red band and a blue band, Jil
Romashka-Z-Leto [24]

Answer:

Robert

Explanation:

There is not more than one colour

4 0
3 years ago
Which of the following objects would take you the greatest amount of force to accelerate?
horsena [70]

Complete question is;

Which of the following object would take you the greatest amount of force to accelerate.

A) a soccer ball with a mass of 0.5 kg

B) a refrigerator with a mass of 200 kg, C) a bike with a mass of 25 kg

D) a car with a mass of 5,000 kg,

Answer:

D) a car with a mass of 5,000 kg

Explanation:

Formula for force is;

F = ma

Where;

F is force

m is mass

a is acceleration

Now, Force is directly proportional to the acceleration and mass.

Thus, the higher the mass, the greater the force.

Thus, the object that will require the most force is the one that has the highest mass.

Looking at the options, the one with the highest mass is option D.

3 0
3 years ago
Which of the following units are commonly used in chemistry? A Kelvin b ampere c fluid ounce d kilogram ​
sdas [7]

Explanation:

your answer is Kelvin because it is the SI unit of temperature

7 0
2 years ago
The decomposition of N2O to N2 and O2 is a first-order reaction. At 730°C, the rate constant of the reaction is 1.94 × 10-4 min-
grin007 [14]

Answer:

Total pressure 5.875 atm

Explanation:

The equation for above decomposition is

2N_2O \rightarrow 2N_2 + O_2

rate constant k =  1.94\times 10^{-4} min^{-1}

Half life t_{1/2} = \frac{0.693}{k} = 3572 min

Initial pressure N_2 O = 4.70 atm

Pressure after 3572 min = P

According to first order kinematics

k = \frac{1}{t} ln\frac{4.70}{P}

1.94\times 10^{-4} = \frac{1}{3572} \frac{4.70}{P}

solving for P we get

P = 2.35 atm

2N_2O \rightarrow 2N_2 + O_2

initial           4.70                         0             0

change        -2x                          +2x           +x

final             4.70 -2x                     2x           x

pressure ofO_2 after first half life  = 2.35 = 4.70 - 2x

                                                          x = 1.175

pressure of N_2 after first half life  =  2x = 2(1.175) = 2.35 ATM

Total pressure  = 2.35 + 2.35 + 1.175

                          = 5.875 atm

5 0
3 years ago
Read 2 more answers
19) Which set of coefficients correctly balances this chemical equation?*
Bas_tet [7]

Answer:

6,1,2

Explanation:

_Ag + _N2 => _Ag3N

LHS RHS

Ag=1×6=3 Ag=3×2=6(Balanced)

N=2×1=2 N=1×2=2(Balanced)

coefficient=6,1,2

4 0
3 years ago
Other questions:
  • What would the volume (L) of 6.6 g of CO2 be if it were measured at the same temperature and pressure as that of the experiment
    11·1 answer
  • a dog is trained to sit and shake hands. These traits are most likely? a. inherited b. not inherited c. not acquired d. innate
    15·1 answer
  • Before entering the cyclotron, the particles are accelerated by a potential difference V. Find the speed v with which the partic
    5·1 answer
  • At elevated temperatures, dinitrogen pentoxide decomposes to nitrogen dioxide and oxygen:_________.
    15·1 answer
  • Predict the number of each atom needed to form a molecule of potassium Sulfide.
    13·1 answer
  • Which isotope of lead has a double magic number? (1) Pb-206 (2) Pb-207 (3) Pb-208 (4) Pb-209
    12·1 answer
  • Write the complete balanced equation for the reaction between iron (III) oxide (Fe2O3) and water (H2O). You do not need to make
    8·2 answers
  • How many moles of carbon dioxide can be produced when 3.05 of calcium carbonate are heated​
    13·1 answer
  • What volume of nitrogen gas at STP would react with 37.2 g of magnesium to produce magnesium nitride
    11·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!