1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mila [183]
3 years ago
5

Select the correct answer. In which state does the precipitate exist in a precipitation reaction? A. Aqueous B. Liquid C. Solid

D. Soluble
Biology
2 answers:
lisov135 [29]3 years ago
6 0

B. liquid! Becuase its Seperational atoms have a Huge Attraction within Heated Atoms..from the Sunlight It then sweats..It starts too Evaperate then later by time it Rains.. Etc "Water Cycle" correct me if im Wrong..

GalinKa [24]3 years ago
6 0

Answer: Option (C) is the correct answer.

Explanation:

A precipitation reaction is a reaction in which two aqueous solution chemically react with each other resulting in the formation of an insoluble solid.

This insoluble solid is known as precipitate.

For example, AgNO_{3}(aq) + CaCl_{2}(aq) \rightarrow AgCl(s) + Ca(NO_{3})_{2}(aq)

In this reaction, AgCl is the precipitate that is formed.

Therefore, we can conclude that in solid state the precipitate exist in a precipitation reaction.

You might be interested in
2.
Mama L [17]

Answer:C insertion of C at the start of the sequence

Explanation:

7 0
2 years ago
Which best describes meiosis?
crimeas [40]
It produces male and female sex cells
8 0
3 years ago
Read 2 more answers
10 POINTS
Brrunno [24]

Answer:

450 kilocalories.

Explanation:

Since only 1/10th of the energy that an organism consumes is passed onto the next level of the pyramid, that would mean only 500/10 = 50 kilocalories are passed on, and the remaining 500 - 50 = 450 kilocalories are used up.

Hope this helped!

4 0
2 years ago
Read 2 more answers
Osteoarthritis is a disease that results in a thinned or absent layer of cartilage surrounding bones, causing bones to rub again
Diano4ka-milaya [45]

The correct answer is connective tissue.

Osteoarthritis refers to the most general kind of arthritis, influencing various individuals all over the globe. It takes place when the protective cartilage on the terminals of the bones wears down with time.

However, osteoarthritis can destruct any joint in the body; the ailment most usually influences the joints in the knees, hands, spine, and hips. Cartilage is a flexible connective tissue, found in the articulating surfaces of the joints. Thus, the condition osteoarthritis affects the connective tissue.

8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Other questions:
  • Ill give brainliest
    15·1 answer
  • How is it that the same tertiary structure of a protein can result from different primary structures? Select one: a. Any protein
    5·1 answer
  • Both aerobic and anaerobic respiration yield a net gain of ATP molecules to be used as energy for living things. The processes o
    8·2 answers
  • 1. Why are viruses considered nonliving but bacteria are considered living? Give two reasons. (1 point)
    7·1 answer
  • Water acts as a ____:<br> A) Solvent<br> B) Solute<br> C) Solution<br> D) Mixture
    7·2 answers
  • Which location is the source of magma
    5·2 answers
  • Which statement about technology is true? Technology improves a scientist’s ability to make observations. Technology does not ha
    14·2 answers
  • Where in the plant does photosynthesis occur? *<br> A. Leaves<br> B. Flower<br> C. Roots<br> D. Stem
    12·1 answer
  • QUESTION 1 Genetic information has become part of our culture and it is difficult to tell the difference between unmodified and
    12·1 answer
  • Explain how the use of poisons to combat pests has led to resistance in pest populations such as rats
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!