1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anvisha [2.4K]
3 years ago
13

A gaseous mixture contains 434.0 Torr H 2 ( g ) , 434.0 Torr H2(g), 389.9 Torr N 2 ( g ) , 389.9 Torr N2(g), and 77.9 Torr Ar (

g ) . 77.9 Torr Ar(g). Calculate the mole fraction, χ , χ, of each of these gases.
Chemistry
1 answer:
weqwewe [10]3 years ago
8 0

Answer:

H₂: 0.48,  N₂: 0.43;  Ar: 0.09

Explanation:

First of all, sum all the pressures to know the total pressure in the mixture.

434 Torr + 389.9 Torr + 77.9 Torr = 901.8 Torr

Mole fraction = Pressure gas / Total Pressure

Mole Fraction H₂: 434 Torr /901.8 Torr = 0.48

Mole Fraction N₂: 389.9 /901.8 Torr =0.43

Mole Fraction Ar:  77.9 /901.8 Torr = 0.09

Remember: <u>SUM OF MOLE FRACTION = 1</u>

You might be interested in
Crude petroleum is a mixture of many different components. How might one separate out the components to begin the process of ref
dimaraw [331]

Fractional distillation is used for the refining of crude petroleum.

<h3>How are the components of crude petroleum separated out?</h3>

Fractional distillation is the procedure used to separate crude oil's numerous constituents.

  • A mixture is divided into several components, known as fractions, using fractional distillation.
  • A combination of hydrocarbons makes up crude oil. The crude oil evaporates, and in the fractionating column, its vapors condense at various temperatures.
  • The hydrocarbon molecules in each percent have a comparable number of carbon atoms and a comparable range of boiling points.
  • The mixture is placed above a tall fractionating column that has multiple condensers coming off at various heights.
  • The bottom of the column is warm, while the top is cool. High boiling point compounds condense at the bottom, whereas low boiling point substances condense as they ascend.

Learn more about fractional distillation here:

brainly.com/question/15187318

#SPJ4

8 0
1 year ago
Something that dissolves in liquid <br><br>solven<br> solute<br> solution ​
Feliz [49]

Answer: solute

Explanation:

6 0
2 years ago
What is the mass of one mole of Cl2
vlada-n [284]

Answer:

70.906 g/mol

Explanation:

7 0
2 years ago
Read 2 more answers
How much energy is evolved during the formation of 197 g of Fe, according to the reaction below?
hoa [83]

Answer:

ΔH for formation of 197g Fe⁰ = 1.503 x 10³ Kj => Answer choice 'B'

Explanation:

Given Fe₂O₃(s) + 2Al⁰(s) => Al₂O₃(s) + 2Fe⁰(s) + 852Kj

197g Fe⁰ = (197g/55.85g/mol) = 3.527 mol Fe⁰(s)

From balanced standard equation 2 moles Fe⁰(s) => 852Kj, then ...

3.527 mole yield (a higher mole value) => (3.527/2) x 852Kj = 1,503Kj (a higher enthalpy value).

______

NOTE => If 2 moles Fe gives 852Kj (exo) as specified in equation, then a <u>higher energy value</u> would result if the moles of Fe⁰(s) is <u>higher than 2 moles</u>. The ratio of 3.638/2 will increase the listed equation heat value to a larger number because 197g Fe⁰(s) contains more than 2 moles of Fe⁰(s) => 3.527 mole Fe(s) in 197g.  Had the problem asked for the heat loss from <u>less than two moles Fe⁰(s)</u> - say 100g Fe⁰(s) (=1.79mole Fe⁰(s)) - then one would use the fractional ratio (1.79/2) to reduce the enthalpy value less than 852Kj.  

8 0
2 years ago
Write and balance molecular equations for the following reactions between aqueous solutions. You will need to decide on the form
musickatia [10]

Answer:

This is the balanced equation:

Pb(NO₃)₂ (aq) + 2NaI (aq) → 2NaNO₃ (aq)  +  PbI₂ (s) ↓    

Explanation:

This are the reactants:

PbNO₃

NaI

Iodide can react to Pb²⁺ to make a solid compound.

4 0
3 years ago
Other questions:
  • What are the uses of zinc
    12·2 answers
  • Reactions which do not continue to completion are called _____reactions
    7·2 answers
  • How much organic chemistry do i need to know for polymers?
    10·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The model below shows an atom of an element. 10 light gray and 8 dark gray balls sit at the center with 2 concentric black rings
    16·2 answers
  • The process___helps us to calculate specific heat of unknown samples/metals OR helps us calculate changes due to energy transfer
    15·1 answer
  • The compound chromium(II) chloride is a strong electrolyte. Write the transformation that occurs when solid chromium(II) chlorid
    5·1 answer
  • What species is reduced in the reaction below?
    15·1 answer
  • CAN YALL PLEASE HELP?!?!
    9·1 answer
  • If brainly deletes one more of my answers when im just answering the question correctly im suing bro
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!