1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
3 years ago
7

30 POINTS!which FIVE statements are correct about PHOTOSYNTHESIS?

Chemistry
2 answers:
Vanyuwa [196]3 years ago
8 0

Answer:

A,B,C,E,H,J

Explanation:

Hatshy [7]3 years ago
5 0

Answer:

the answers are b, c, e, h, and j

You might be interested in
An ideal gas (C}R), flowing at 4 kmol/h, expands isothermally at 475 Kfrom 100 to 50 kPa through a rigid device. If the power pr
Zina [86]

<u>Answer:</u> The rate of heat flow is 3.038 kW and the rate of lost work is 1.038 kW.

<u>Explanation:</u>

We are given:

C_p=\frac{7}{2}R\\\\T=475K\\P_1=100kPa\\P_2=50kPa

Rate of flow of ideal gas , n = 4 kmol/hr = \frac{4\times 1000mol}{3600s}=1.11mol/s    (Conversion factors used:  1 kmol = 1000 mol; 1 hr = 3600 s)

Power produced = 2000 W = 2 kW     (Conversion factor:  1 kW = 1000 W)

We know that:

\Delta U=0   (For isothermal process)

So, by applying first law of thermodynamics:

\Delta U=\Delta q-\Delta W

\Delta q=\Delta W      .......(1)

Now, calculating the work done for isothermal process, we use the equation:

\Delta W=nRT\ln (\frac{P_1}{P_2})

where,

\Delta W = change in work done

n = number of moles = 1.11 mol/s

R = Gas constant = 8.314 J/mol.K

T = temperature = 475 K

P_1 = initial pressure = 100 kPa

P_2 = final pressure = 50 kPa

Putting values in above equation, we get:

\Delta W=1.11mol/s\times 8.314J\times 475K\times \ln (\frac{100}{50})\\\\\Delta W=3038.45J/s=3.038kJ/s=3.038kW

Calculating the heat flow, we use equation 1, we get:

[ex]\Delta q=3.038kW[/tex]

Now, calculating the rate of lost work, we use the equation:

\text{Rate of lost work}=\Delta W-\text{Power produced}\\\\\text{Rate of lost work}=(3.038-2)kW\\\text{Rate of lost work}=1.038kW

Hence, the rate of heat flow is 3.038 kW and the rate of lost work is 1.038 kW.

4 0
3 years ago
Match each of the following topical dosage forms with its correct definition.
Dmitry [639]

Answer:

cream - contains a higher proportion of oil than water

ointment - dr4g mixed in approximately equal proportions of oil and water

i don't know about the other two sorry

8 0
1 year ago
The balanced equation for a hypothetical reaction is a + 5b + 6c → 3d + 3e. what is the rate law for this reaction? rate = k [a]
nekit [7.7K]

<u>Answer: </u>The correct rate of the reaction is Rate=k[a][b]^5[c]^6

<u>Explanation:</u>

Rate law of the reaction is the expression which expresses the rate of the reaction in the terms of the molar concentrations of the reactants with each term raised to the power of their respective stoichiometric coefficients in a balanced chemical equation.

For the given reaction:

a+5b+6c\rightarrow 3d+3e

The expression for the rate law will be: Rate=k[a][b]^5[c]^6

7 0
3 years ago
What happens to an electron during an electron transition?
ICE Princess25 [194]
I think the answer is d not real fir sure I'll find out in the morning sorry
4 0
3 years ago
That's how you can
kirza4 [7]
2)8/8-9_12-/78)022-/7/$
6 0
3 years ago
Other questions:
  • What two nuclei are fused in the main fusion reaction of the sun? A. helium and helium B. helium and thorium C. hydrogen and hel
    7·2 answers
  • Describe, in detail, nuclear fission and nuclear fusion. Include what happens in each reaction, the types of atoms involved, the
    9·1 answer
  • Which of these elements has the smallest atomic radius?
    5·1 answer
  • Fluorine is a toxic, reactive gas. Witch representation (structural formula, electron dot structure, or three-dimensional model)
    8·1 answer
  • If you are given an ideal gas with pressure (P) = 259,392.00 Pa and temperature (T) = 2.00 oC of 1 mole Argon gas in a volume of
    6·1 answer
  • Someone plz help me write notes (images attached)
    11·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Which of the following organisms do not produce uric acid as the excretory product?​
    9·1 answer
  • What is the chemical name of the covalent compound SF6?
    7·1 answer
  • 3. Mothballs in a clothes closet gradually disappear over time. What happens to this<br> material?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!