1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nookie1986 [14]
3 years ago
12

What is produced in the electrolysis of brine?

Chemistry
1 answer:
ziro4ka [17]3 years ago
7 0

High concentration of water and salt is the main ingredient of brine. Salt being NaCl and water make brain and important solution in making of chlorine.

Electric terminals are put inside the solutions and with the help of electric current the chemical properties of the solution are changed such that we get chlorine as outcome. This process is carried out in a large scale to get chlorine from NaCl in solution and is called electrolysis of Brine.

You might be interested in
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
hellllpppppp pleaseeeeee i will give brainliest and don't forget to show proof, don't say "i already learned this" or "just trus
Leni [432]
It’s c sun moon and earth line up with the moon in the middle
3 0
2 years ago
Plz answer!!! Due in 10 minutes!!! Will give BRAINLIEST and extra points to first correct answer!!!
Ugo [173]

Answer:

B

Explanation:

u do the math and you will get the answer

8 0
3 years ago
Read 2 more answers
When energy transforms, which of the following does it produce?
Aliun [14]

motion

Explanation:

it works in our daily life

8 0
3 years ago
The vapor pressure of methanol is 143 mmhg. identify the best reason to explain why methanol spontaneously evaporates in open ai
goldfiish [28.3K]

Answer/Explanation:

Methanol has a molecular weight (32.04 g/mol), low-boiling point and because of its low boiling point, methanol readily evaporates at room temperature.

Under these specified non-standard conditions, the partial pressure of methanol is lower than its vapor pressure and this explains the reason for the spontaneous evaporation exhibited by methanol.

6 0
3 years ago
Other questions:
  • The rows of a periodic table are called _____(1)______ and the columns are called ____(2)________.1) periods, (2) points
    12·2 answers
  • A _________________ is developed through the scientific method, and it can be modified or improved upon. It may be represented b
    10·2 answers
  • Calculate the density of a substance that has a mass of 200 g and volume of 228 ml​
    8·1 answer
  • Surface currents are caused by ______ .
    8·2 answers
  • What type of energy is this?
    7·1 answer
  • Rank the following quantities from smallest to largest: 5,200, dozen, pair,gross,ream.
    13·1 answer
  • Why is the wavelength of 633 nm used to analyze the standard solutions and drink samples?
    10·1 answer
  • What are the properties of water that make it unique
    5·1 answer
  • What is the mass in grams of Al that were reacted with excess HCl if 2.12 L of hydrogen gas were collected at STP in the followi
    8·2 answers
  • Please help me need ASAP number 9 and 11 please
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!