Hey there!
A half-life means after a certain amount of time, half of that substance will be gone/changed after that time.
If 50%, or half, of the element remains after 4000 years, that means the half life must be 4000 years.
Hope this helps!
Given question is incomplete. The complete question is as follows.
Balance the following equation:
Answer: The balanced chemical equation is as follows.
Explanation:
When a chemical equation contains same number of atoms on both reactant and product side then this equation is known as balanced equation.
For example,
Number of atoms on reactant side:
H = 5
P = 1
O = 6
Ca = 1
Number of atoms on product side:
H = 6
P = 2
O = 9
Ca = 1
In order to balance this equation, we will multiply 
by 2 on reactant side and we will multiply 
by 2 on product side. Hence, the balanced chemical equation is as follows.
Volume of a substance can be determined by dividing mass of the substance by its density.
That can be mathematical shown as:
Density=Mass/Volume
So, Volume=Mass/Density
Here mass of the substance given as 24.60 g
Whereas density of the substance is 2.70 g/mL
So,
Volume=Mass/Density
=24.6/2.7
=9.1 mL
So volume of the substance is 9.1 mL.
Answer:
The answer to the question is
The pressure of carbon dioxide after equilibrium is reached the second time is 0.27 atm rounded to 2 significant digits
Explanation:
To solve the question, we note that the mole ratio of the constituent is proportional to their partial pressure
At the first trial the mixture contains
3.6 atm CO
1.2 atm H₂O (g)
Total pressure = 3.6+1.2= 4.8 atm
which gives
3.36 atm CO
0.96 atm H₂O (g)
0.24 atm H₂ (g)
That is
CO+H₂O→CO(g)+H₂ (g)
therefore the mixture contained
0.24 atm CO₂ and the total pressure =
3.36+0.96+0.24+0.24 = 4.8 atm
when an extra 1.8 atm of CO is added we get Increase in the mole fraction of CO we have one mole of CO produces one mole of H₂
At equilibrium we have 0.24*0.24/(3.36*0.96) = 0.017857
adding 1.8 atm CO gives 4.46 atm hence we have
(0.24+x)(0.24+x)/(4.46-x)(0.96-x) = 0.017857
which gives x = 0.031 atm or x = -0.6183 atm
Dealing with only the positive values we have the pressure of carbon dioxide = 0.24+0.03 = 0.27 atm
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
