1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vikki [24]
3 years ago
12

A 1.50 L sample of H₂ gas at 3.50 atm was combined with 2.00 L of N₂ gas at 2.55 atm pressure at a constant temperature of 25.0

°C into a 9.10 L flask. The total pressure in the flask is __________ atm. Assume the initial pressure in the flask was 0.00 atm. R = 0.08206 (L*atm)/(mol*K)
Chemistry
1 answer:
Mademuasel [1]3 years ago
3 0

Answer:

The total pressure in the flask is 1,14 atm

Explanation:

We need to apply the Ideal Gas law to get the moles and then find out the total moles in the mixture

moles H2 + moles N2

P.V = n. R . T

1,50 L . 3,50atm = n . 0,08206  (L*atm)/(mol*K) . 298K

(1,50 L . 3,50atm) / 0,08206 (mol*K)/(L*atm) . 298K = n

(5,25 / 24,45) mol = n = 0,215 moles H2

2,55 atm . 2,00 L = n . 0,08206  (L*atm)/(mol*K) . 298K

(2,55 atm . 2,00 L) / 0,08206 (mol*K)/(L*atm) . 298K = n

(5,1 / 24,45) mol = n = 0,208 moles N2

Total moles = moles H2 + moles N2

0,215 moles H2 + 0,208 moles N2 = 0,423 moles

P.V = n. R . T

P . 9,10L = 0,423moles . 0,08206  (L*atm)/(mol*K) . 298K

P = (0,423moles . 0,08206 (L*atm)/(mol*K) . 298K ) / 9,10L

P = 1,14 atm

You might be interested in
PLZ HELP ME. This is my second time posting my question because the first time a person put a random answer. If you do not know
kupik [55]

Answer:

PLZ HELP ME. This is my second time posting my question because the first time a person put a random answer. If you do not know the question please do not answer it and leave it to someone else. Thank you, and my question is on the attached image below.

5 0
3 years ago
Read 2 more answers
Discuss elements and compounds by completing the following paragraph
pychu [463]

Elements are substances that are made up of the same atoms which are capable of taking part in a chemical reaction.

There are different types of elements which are represented by symbols gotten from the first letter or the first and any other letter in the name of the element.

Examples of elements include:

  • Hydrogen (H)
  • Carbon (C)
  • Nitrogen (N)
  • Sodium (Na)

When two or more of these elements combine together through a chemical bond, it leads to the formation of compounds.

Example of a compound includes:

  • NaCl: The element sodium combine, through electrochemical bonding, with another element chlorine to form the compound sodium chloride.

Learn more here:

brainly.com/question/17571315

3 0
3 years ago
What does squeezing do to the particles of snow or ice?​
3241004551 [841]

Answer:

crushes the ice to compaction and satasfation

3 0
3 years ago
Read 2 more answers
What problems could arise if scientists use different units to measure height
Shkiper50 [21]

Scientists can measure the height in different units but problem could arise when they compare all the measurements. That is the reason there is standard units for measurements.

<span>There may be error arises when an American scientist is measuring the height of an object in inches and other Australian scientist is measuring the height of same object in meters. Their data cannot be compared because they are using different units to measure height.</span>

5 0
3 years ago
Which of the following compounds is least soluble in water?
hjlf

Answer:

3) iron (iii) hydroxide

Explanation:

4 0
2 years ago
Other questions:
  • A sample of 2.0 moles of a metal reacts completely with excess oxygen to form 62.0 g of M2O. What element is represented by the
    10·1 answer
  • Wait so wats the answer to this question
    9·1 answer
  • Most scientific questions are based on opinions. hypotheses. observations. experimental dat
    14·1 answer
  • An open flask sitting in a lab refrigerator looks empty, but it is actually filled with a mixture of gases called air. If the fl
    11·1 answer
  • How much 0.075 M NaCl solution can be made by diluting 450 mL of 9.0 M NaCl?
    6·1 answer
  • Which expression represents the pH of a solution?
    7·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • 450 ft to meters (show work)
    14·1 answer
  • Do you think the video game "Minecraft" will ever die?
    8·2 answers
  • Which of the following equations is balanced?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!