1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rus_ich [418]
3 years ago
5

The pressure of a basketball is 412 mmHg. How many kPa is that equal to?

Chemistry
1 answer:
pychu [463]3 years ago
3 0

Answer:

d. 54.9 kPa

Explanation:

mmHg and Pa are units of pressure used in chemistry principally in the study of gases. 1mmHg is equal to 133.322Pa. 412mmHg are:

412 mmHg * (133.322Pa / 1mmHg) = 54929 Pa

The prefix K (Kilo) represents one thousand of the determined unit.

54929Pa are:

54929Pa * (1KPa / 1000Pa) = 54.9kPa

Right answer is:

<h3>d. 54.9 kPa </h3>

You might be interested in
Explain why science is a continuous profession of study.
xxMikexx [17]
Science is a continuous profession of study because new ideas are produced based on new evidence. Also, there are different topics of science such as climate change or new cures to different diseases.
3 0
3 years ago
Which of these is a compound?<br><br> A. Steel<br><br> B.Sugar<br><br> C.Air<br><br> D.Nitrogen
hjlf

Sugar is a compound made of carbon, hydrogen and oxygen.

8 0
3 years ago
Read 2 more answers
How many moles of ions are produced by ionization of 2 moles of MgCl2
tensa zangetsu [6.8K]

Answer:

number of ions = 12.04 x 10^²³

Explanation:

n = number of ions/Avogadro's constant

2 = number of ions/6.02 x 10^²³

number of ions= 2 x 6.02 x 10^²³

number of ions = 12.04 x 10^²³

3 0
2 years ago
Question 3<br> 6.06 X 103 L<br> How many significant figures are there
VashaNatasha [74]
There should be 22 figures .
4 0
2 years ago
What would I write in there? I’m confused
pav-90 [236]
I assume what they are asking you? Sorry if that sound mean
3 0
2 years ago
Other questions:
  • What is water? pls tell fast
    8·2 answers
  • A<br> In 25 words or fewer, what is the scientific question for the boiling<br> water experiment?
    14·1 answer
  • For the reaction 2Fe + O2 = 2FeO, how many grams of iron oxide are produced from 8.00 mol of iron? when o2 is an excess
    8·1 answer
  • he carbon-14 isotope is important because it allows scientists to determine the ___________ of an organic sample. A) age B) dens
    9·1 answer
  • Please help! What does implementing mean?
    13·1 answer
  • How many moles are equivalent to 365 g of aluminum chloride? Using the dimensions analysis. Show work
    7·1 answer
  • The graph below shows how the temperature and volume of a gas vary when
    13·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Annual precipitation rates can be collected for several years, added together, and divided by the number of years to obtain an a
    7·1 answer
  • If oxygen has a molar mass of 16.0 g/mole, carbon has a molar mass of 12.0 g/mole and hydrogen has a molar mass of 1.01 g/mole,
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!