Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
6.4 g BaSO₄
Explanation:
You have been given the molarity and the volume of the solution. To find the mass of the solution, you need to (1) find the moles BaSO₄ (via the molarity ratio) and then (2) convert moles BaSO₄ to grams BaSO₄ (via the molar mass). It is important to arrange the conversions in a way that allows for the cancellation of units (the desired unit should be in the numerator). The final answer should have 2 sig figs to reflect the sig figs of the given values.
Molarity (mol/L) = moles / volume (L)
(Step 1)
55 mL / 1,000 = 0.055 L
Molarity = moles / volume <----- Molarity ratio
0.5 (mol/L) = moles / 0.055 L <----- Insert values
0.0275 = moles <----- Multiply both sides by 0.055
(Step 2)
Molar Mass (BaSO₄): 137.33 g/mol + 32.065 g/mol + 4(15.998 g/mol)
Molar Mass (BaSO₄): 233.387 g/mol
0.0275 moles BaSO₄ 233.387 g
--------------------------------- x ------------------- = 6.4 g BaSO₄
1 mole
Answer:
jobs growth is a figure measured by the Bureau of Labor Statistics (BLS) that tracks how many jobs are created in the country on a monthly basis. The figure is used as a measure of economic expansion and regarded as a litmus test for national economic health
Explanation:
No. The only thing that changed was the looks of the gasoline, not the chemical components.
