1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitry [639]
2 years ago
5

Which material in the picture absorbs the most light

Chemistry
1 answer:
Naya [18.7K]2 years ago
5 0

is there a picture??

You might be interested in
HELP ME! If I get an F on my test I’m getting kicked out:(
satela [25.4K]

Answer:

It is just slightly less abundant than its alkali cousin, sodium. Potassium is less dense than water, so it can float on water. However, chemically, potassium reacts with water violently. It will give off hydrogen and eventually catch fire.

3 0
2 years ago
Why melting and boiling points can be used as a way to check purity?​
jekas [21]

Answer: Let's see why

Pure solid and liquid compounds possess sharp melting and boiling points. Therefore, melting and boiling points of a compound can be used as a criteria of purity. ... Sometimes during cooling minute quantity of the substance (solid which is being purified) is added to the solution to facilitate the initial crystallisation.

Explanation:

6 0
2 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
2 years ago
An insoluble solid that forms from a chemical reaction is called a(n)
Kisachek [45]
This description applies and is suitable for what a chemical precipitate is. A precipitate is a product that is formed from a certain chemicals reaction that yields a solid that is insoluble in the reaction vessel. It is usually white and opaque.
4 0
3 years ago
How is electron movement related to the bonding in sodium chloride?
stepladder [879]
Cl is highly electronegative and will actually pull away 1 electron from sodium, forming an ionic bond. 
5 0
3 years ago
Read 2 more answers
Other questions:
  • What is the concentration of a solution prepared by placing 20. mL of 0.12 M K2S in a graduated cylinder and pouring water until
    12·1 answer
  • Hi i need hel does any one know what P3N2 means ??? .-.
    9·1 answer
  • The compound, (nh4)2s, can be used in analysis for trace amounts of metals present in a sample. what is its name?
    9·2 answers
  • Whats a electron please help meeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee
    13·2 answers
  • Using the equation PCl S(g) PCl 3(g) +Cl 2(g) , if PCl 3 is added, what way will the equilibrium shift?
    15·1 answer
  • From what group must the terminal atoms come in an abx molecule where the central atom is from group 6a, for the electron-domain
    5·2 answers
  • 10 point + brainlyiest= 1 big thank u
    9·2 answers
  • The first two ionization energies of nickel.
    15·1 answer
  • The metabolic oxidation of glucose, C6H12O6, in our bodies produces CO2, which is expelled from our lungs as a gas:
    9·2 answers
  • Please help as soon as possible I will give out 100 points and Brian less
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!