1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
m_a_m_a [10]
3 years ago
5

Who was the first to propose the idea of atoms?

Chemistry
2 answers:
VMariaS [17]3 years ago
5 0

Answer::Democritus

Explanation

The idea that all matter is made up of tiny, indivisible particles, or atoms, is believed to have originated with the Greek philosopher Leucippus of Miletus and his student Democritus of Abdera in the 5th century B.C. (The word atom comes from the Greek word atomos, which means “indivisible.”) These thinkers held that,

Zielflug [23.3K]3 years ago
4 0

Answer: Democritus

Explanation:

You might be interested in
Be sure to answer all parts. Nitric oxide (NO) reacts with oxygen gas to form nitrogen dioxide (NO2), a dark brown gas: 2NO(g) +
notka56 [123]

<u>Answer:</u> NO is the limiting reagent in the given reaction and 0.857 moles of NO_2 will be produced.

<u>Explanation:</u>

Limiting reagent is defined as the reagent which is present in less amount and it limits the formation of products.

Excess reagent is defined as the reagent which is present in large amount.

For the given chemical reaction:

2NO(g)+O_2(g)\rightarrow 2NO_2(g)

We are given:

Moles of NO = 0.857 mol

Moles of oxygen = 0.498 mol

By stoichiometry of the reaction:

If 2 moles of NO reacts with 1 mole of oxygen gas.

So, 0.857 moles of NO will react with = \frac{1}{2}\times 0.857=0.4285mol of O_2

As, the given amount of oxygen gas is more than the required amount. So, it is considered as an excess reagent.

Thus, NO is considered as the limiting reagent because it limits the formation of products.

By Stoichiometry of the reaction:

If 2 moles of NO produces 2 moles of nitrogen dioxide gas.

So, 0.857 moles of NO will produce = \frac{2}{2}\times 0.857=0.857mol of NO_2

Hence, NO is the limiting reagent in the given reaction and 0.857 moles of NO_2 will be produced.

6 0
3 years ago
Como son los recorridos de los oleoductos y gasoductos en argentina?
lesya692 [45]

Answer:

Estoy confundido.Puedes ser un poco especifico sobre tu pregunta?

Explanation:

8 0
3 years ago
How many grams are in 6.00 moles of NaCl?
Anastasy [175]

Is it 350.4, I assume?

5 0
3 years ago
Read 2 more answers
A golf pro has 2100 J of kinetic energy and swings his driver which weighs .75 kg. What is the speed of his swing?
jeka57 [31]

Answer : The correct answer is 74.83 m/s .

The kinetic energy is energy possessed by any mass which is moving or have some speed . It is product of mass and velocity . It is expressed as :

KE = \frac{1}{2}  * m* v^2

Where KE = kinetic energy in J or kg\frac{m^2}{s^2} m = mass in Kg v = speed in m/s²

Unit of KE is Joules (J) .

Givne : KE = 2100 J mass = 0.75 kg v = ?

Plugging value in KE formula =>

2100 J = \frac{1}{2}  * 0.75 Kg * v^2

2100 J = 0.375 Kg * v^2

Dividing both side by 0.375 kg =>

\frac{2100 J}{0.375 Kg}  = \frac{0.375 Kg}{0.375 Kg } * v^2

v^2 = 5600 \frac{m^2}{s^2}

v= 74.83 \frac{m}{s}

8 0
3 years ago
Read 2 more answers
A flask has a mass of 78.23g when empty and 593.63g when filled with water.When the same flask is filled with concentrateds ulfu
butalik [34]

Answer:

Density of concentrated H2SO4 = 1.99g/cm^3 = 1991.79Kg/m^3

Explanation:

mass of empty flask = 78.23g mass of flask filled when with water = 593.63g.

mass of flask filled when with concentrateds sulfuric acid, H2SO4 = 1026.57g

Mass of water = (mass of flask filled when with water) -

(mass of empty flask) = 593.63g - 78.23g = 515.4g

Volume of flask = volume of water = volume of concentrateds sulfuric acid, H2SO4 =

(mass of water)/ density of water) = 515.4g/1.00g/cm^3 = 515.4cm^3

The density of concentrated sulfuric acid is given by

Density of concentrated H2SO4 = (mass of H2SO4) ÷ (volume of H2SO4) = 1026.57g/515.4cm^3 = 1.99g/cm^3 = 1991.79Kg/m^3

7 0
3 years ago
Other questions:
  • Which of the following would represent a single displacement reaction between Potassium Bromide (K^+Br^-) and Iodine (I), which
    12·1 answer
  • Chemistry:give the number of significant figures in this number: 0.025
    6·1 answer
  • What's a good science project?
    10·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Iron(II) chloride and sodium carbonate react to make iron(II) carbonate and sodium chloride: FeCl2(aq) + Na2CO3(s) → FeCO3(s) +
    15·2 answers
  • D) 7
    9·1 answer
  • How much heat energy is required to boil 66.7 g of ammonia, NH3? The molar heat of vaporization of ammonia is 23.4 kJ/mol.
    8·1 answer
  • 1.
    9·1 answer
  • Why do the ions gains an electron after being detected in TOF
    11·1 answer
  • A molecule has an empirical formula of ch, and its molar mass is known to be 26 g/mol. What is its molecular formula?.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!