<h3><u>Answer;</u></h3>
10.80 ° C
<h3><u>Explanation;</u></h3>
From the information given;
Initial temperature of water = 24.85°C
Final temperature of water = 35.65°C
Mass of water = 1000 g
The specific heat of water ,c = 4.184 J/g °C.
The heat capacity of the calorimeter = 695 J/ °C
Change in temperature ΔT = 35.65°C - 24.85°C
= 10.80°C
Answer:
The Equilibrium constant K is far greater than 1; K>>1
Explanation:
The equilibrium constant, K, for any given reaction at equilibrium, is defined as the ratio of the concentration of the products raised to their stoichiometric coefficients divided by the concentration of reactants raised to their stoichiometric coefficients.
It tells us more about how how bigger or smaller the concentration of products is to that of the reactants when a reaction attains equilibrium. From the given data, as the color of the reactant mixture (Br2 is reddish-brown, and H2 is colourless) fades, more of the colorless product (HBr is colorless) is being formed as the reaction approaches equilibrium. This indicates yhat the concentration of products becomes relatively higher than that of the reactants as the reaction progresses towards equilibrium, the equilibrium constant K, must be greater than 1 therefore.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
There are two valence electrons in a single atom of magnesium.