false
because science is an ever-growing subject we can never stop learning from it and expanding our knowledge.
(sorry that's the best that I can do)
Answer:
884.56 torr
Explanation:
Formula: 
P = Pressure
V = Volume
T = Temperature in kelvin (Celsius + 273.15)
P = 884.56169
Answer:
QP
Explanation:
P has 9 electrons.
Electronic Configuration : 2, 7
Valence electrons : 7
P needs 1 electron to get stable electronic configuration.
Q has 3 electrons.
Electronic Configuration : 2, 1
Valence electrons : 1
P needs to loose 1 electron to get stable electronic configuration.
Q donates 1 electron,
Q -----> Q+ + 1 e-
P gains 1 electron,
P + 1 e- -----> P-
Q+ + P- -----> QP
This is an ionic compound.
B. Most rocks are composed of single mineral
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
