1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dalvyx [7]
3 years ago
5

What's the difference between a word equation and a formula equation?

Chemistry
1 answer:
KonstantinChe [14]3 years ago
8 0

Answer:

b ,Word equations give qualitative information about the reaction.

Explanation:

Word equation can give only qualitative information about reactants and products. While formula equation gives quantitative information about reactant and products.

For example:

Photosynthesis reaction:

It is the process in which in the presence of sun light and chlorophyll by using carbon dioxide and water plants produce the oxygen and glucose.

Word equation:

Carbon dioxide + water  →   glucose + oxygen

water is supplied through the roots, carbon dioxide collected through stomata and sugar and oxygen are formed. This equation only provide the qualitative data which type of reactants and product are present.

Formula equation:

6H₂O + 6CO₂  →   C₆H₁₂O₆ + 6O₂

water and carbon dioxide react to form sugar and oxygen.

it is known from balanced chemical equation that 6 moles of carbon dioxide react with the six moles of water and created one mole of glucose and six mole of oxygen.

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
I have 2 Valence electrons and 1 energy levels
natima [27]

Answer:

Hydrogen(H) and Heluim(He)

Explanation:

These are the only two valennce electrons and 1 energy levels.

3 0
3 years ago
Read 2 more answers
Freeeeeeeeeeee<br> Poinnnnnnntttsss
Marina CMI [18]
Hellllooooo how are you
8 0
3 years ago
Read 2 more answers
Please help me out with this question
grigory [225]
C. Electrical conductivity, that means it can pass electricity through wires if needed, think of your phone charger as an example
3 0
3 years ago
Read 2 more answers
Many scientist compare the parts of a cell to the parts of a factory. Do you think this comparison is fair and useful?
Fittoniya [83]
Yes. Parts of a cell work together just like stations in a factory.
4 0
3 years ago
Other questions:
  • When determining if a bond is polar, we must evaluate the difference in electronegativity (δen) of the atoms involved in the bon
    7·1 answer
  • Restate the 4 laws that govern energy.
    14·2 answers
  • Which compound is soluble in water?(1) PbS (3) Na2S(2) BaS (4) Fe2S3
    11·1 answer
  • Siya saw two elements X and Y. Element X is shiny and hard, while element Y is dull and
    10·1 answer
  • How do you define an anion?
    10·2 answers
  • Convert 550 cm into m. Please show your work.
    8·1 answer
  • 1.
    8·1 answer
  • What is Cu,As,Ca,Br listed from most metallic to least metallic?
    11·1 answer
  • Which questions should you consider when analyzing the credibility of a source? Check all that apply.
    12·2 answers
  • What kind of energy is produced from moving water?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!