1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LiRa [457]
3 years ago
9

Can someone help me? 20points plz!!!

Chemistry
1 answer:
valentinak56 [21]3 years ago
4 0
<h2>Answer</h2>

The answer is 38.05 years

<h2>Explanation</h2>

To solve this question, we should convert the given seconds to the year.

So,

Number of seconds in a year = 3.154 * 10^7

Seconds the man lived = 11.2 * 10^9.2 * 10^9

How many years, he lived = ?

Here a unit method will be applied as

Total years the man lived= 1.2 * 10^9/3.154 * 10^7

Total years the man lived = 38.05 years


You might be interested in
Fe(s) + CuSO4(aq) ⇒ Cu(s) + FeSO4(aq)
Alexxandr [17]

Answer:

The answer to your question is CuSO₄

Explanation:

To answer your question just remember the following information

- A chemical reaction is divided into sections

 reactants and products

 reactants on the left side of the reaction

products on the right side of the reaction

- All the symbols have a meaning

 (s) means that that compound is in solid phase

 (aq) means that that compound is dissolved in solution.

Then, the answer is CuSO₄

4 0
3 years ago
Help please I need help with these two questions answer truthfully get brainliest?!!​
irina1246 [14]

Answer:

1. 3x-3=18

Value of x=7

2. 4x-5=23

value of x=7

5 0
3 years ago
Read 2 more answers
PLEASE HELP &amp; SHOW WORK
Olegator [25]

Answer:

1. 0.178 moles ; 2. 8x10²³ atoms ; 3. 7.22x10²³ molecules ; 4. 89.6 g ; 5. 1.34x10²² atoms ; 6. 1.67x10²⁵ molecules

Explanation:

1. Mass / Molar mass = Mol

5g / 28 g/m = 0.178 moles

2. 1 molecule of N₂ has 2 atoms, it is a dyatomic molecule.

4x10²³  x2 = 8x10²³ atoms

3. 1 mol of anything, has 6.02x10²³ particles

6.02x10²³ molecules . 1.2 mol = 7.22x10²³

4. 1 atom of C weighs 12 amu.

4.5x10²⁴ weigh ( 4.5x10²⁴ . 12) = 5.24x10²⁵ amu

1 amu = 1.66054x10⁻²⁴g

5.24x10²⁵ amu = (5.24x10²⁵ . 1.66054x10⁻²⁴) = 89.6 g

5. Molar mass NaCl = 58.45 g/m

1.3 g /  58.45 g/m = 0.0222 moles

1 mol has 6.02x10²³ atoms

0.0222 moles → ( 0.0222 . 6.02x10²³) = 1.34x10²²

6. Density of water is 1 g/mL, so 500 mL are contained in 500 g of water

Molar mass H₂O = 18 g/m

500 g / 18 g/m = 27.8 moles

6.02x10²³ molecules . 27.8 moles = 1.67x10²⁵

8 0
4 years ago
HELP NOW FIRST=BRANILYEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
cestrela7 [59]

Answer:

the answer is c. their atomic masses are different clearly because an atom of gold has 79 protons and the atom can be divided multiple times. An atom of silver has an atomic number of 47. 47 electrons. Clearly different. Hope it helps :)

Explanation:

3 0
3 years ago
Read 2 more answers
Excited state occurs when the electrons are in the _ energy levels.
dexar [7]

Answer:

higher energy level s...........

8 0
3 years ago
Other questions:
  • Elements found to the left of the metalloids on the periodic table display which properties? Select all that apply.
    15·2 answers
  • Which has the largest atomic radius calcium bromide barium and astatine
    12·2 answers
  • Help please .......<br><br>​
    13·1 answer
  • Which element easily loses one electron to form a positive ion? A. Magnesium (Mg) B. Lithium (Li) C. Nitrogen (N) D. Fluorine (F
    5·1 answer
  • 49.Which of the following statements regarding chemical equilibrium is true?
    14·1 answer
  • 2. What happens to the reaction rate if a catalyst is added?
    11·2 answers
  • Where on the pH scale would you find acids? Bases? What is unique about a pH of 7?
    14·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • How is energy from grass passed on between animals
    7·1 answer
  • Which part of the hunman body controls the nervous system
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!