1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olasank [31]
3 years ago
13

How many grams of sodium bromide must be dissolved in 400.0 g of water to produce a 0.500 molar solution?

Chemistry
1 answer:
kiruha [24]3 years ago
8 0

Answer:

D. 20.6g

Explanation:

Molarity is defined as ratio between moles of solute (sodium bromide, NaBr) per liter of water.

As density of water is 1g/mL; volume of 400.0g of water is 400.0mL = 0.4000L.

That means 0.400L of 0.500M solution contains:

0.400L × (0.500mol / 1L) = <em>0.200moles of sodium bromide</em>.

In mass (NaBr = 102.9g/mol):

0.200mol NaBr × (102.9g/mol) = 20.6g of NaBr

Right answer is:

<em>D. 20.6g</em>

You might be interested in
What is it called when energy transfers between objects until they reach the same temperature and their particles move at the sa
wel
I think it is kinetic 
enrgy
6 0
3 years ago
Read 2 more answers
Carbon dioxide, water vapor, and oxygen pass through ---------------
Lelechka [254]
The answer is B) stomata.
5 0
3 years ago
Read 2 more answers
Predict the following chemical formula for a compound between aluminum and chlorine. AlCl3 Al3Cl Al2Cl3 Al3Cl2
Tasya [4]
Both aluminum and chlorine have known charges, which are +3 and -1 respectively. To make them cancel each other out in charge, you would need 3 chlorine and for one aluminum, therefore AlCl_{3} would be correct
7 0
3 years ago
What’s the number 9.1x10^3 in standard form
mafiozo [28]

Answer:

.0091

Explanation:

3 0
3 years ago
[15 Points, Stoichiometry and Gases]
KiRa [710]

The reaction is

CaC₂(s) + 2H₂O (l) -----> Ca(OH)₂ (s) + C₂H₂ (g) ​

As we have data of gas ethyne (or acetylene), C₂H₂

We can calculate the moles of acetylene and from this we can estimate the mass of calcium carbide taken

the moles of acetylene will be calculated using ideal gas equation

PV =nRT

R = gas constant = 0.0821 Latm/molK

T = 385 K

V = volume = 550 L

P = Pressure = 1.25 atm

n = moles = ?

n = PV /RT = 1.25 X 550 / 0.0821 X 385 = 21.75 mol

As per balanced equation these moles of acetylene will be obtained from same moles of calcium carbide

moles of calcium carbide = 21.75mol

molar mass of CaC₂ = 40 + 24 = 64

mass of CaC₂ = moles X molar mass = 21.75 X 64 = 1392g

6 0
3 years ago
Read 2 more answers
Other questions:
  • What occurs only on the surface of the substance
    11·1 answer
  • A chemical reaction in which bonds are broken is usually associated with ________. a synthesis forming a larger molecule the rel
    15·1 answer
  • The diffusion coefficient for sodium ions crossing a biological membrane 12nm thick is 1.5 x10-18 m2/s. what flow rate of sodium
    13·1 answer
  • Is pentacosane a molecular compound?
    10·1 answer
  • What is a Independent variable
    6·2 answers
  • A crime-scene is roped off with yellow tape. The rectangular area is 5.6 meters long 10.75 meters wide. What is the area of the
    15·1 answer
  • Which of the following statements about the compound HCl is true?
    13·2 answers
  • How many grams of Lioh are in 1.7 moles please help
    14·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Increasing which factor will cause the gravitational force between two objects to decrease?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!