1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kobotan [32]
3 years ago
14

Zn(s)+CuSo4(aq) = Cu(s)+ ZnSO4(aq)

Chemistry
1 answer:
Flura [38]3 years ago
6 0

Answer:

Is this a Q? i would like to help but what the heck is this?

Explanation:

You might be interested in
In response to action potentials arriving along the transverse tubules, the sarcoplasmic reticulum releasesA) acetylcholine.B) s
stealth61 [152]

Answer:

Calcium ions.

Explanation:

The generation of the action potential helps in the transfer of information to the different body parts. This potential occurs to the difference in membrane potential inside and outside of the cell.

The sarcoplasmic reticulum is the homologous to the endoplasmic reticulum of the cells. The sarcoplasmic reticulum contains calcium ions in it and releases the stored calcium ions on the generation of the action potential. This calcium ion is important for the action of the actin and myosin.

Thus, the correct answer is option (D).

7 0
3 years ago
How is stoicheometry used to <br>keep camels alive​
Novay_Z [31]

Answer:

by heart beat camel lives

8 0
3 years ago
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
Potassium hydroxide, KOH, is considered a _____________ in an acid-base reaction because it ___________ a hydrogen ion to/from t
siniylev [52]
Answer: Potassium hydroxide, KOH, is considered a <u>BASE</u> in an acid-base reaction because it <u>ACCEPTS</u> a hydrogen ion from the other reactant.

According to Brønsted–Lowry acid–base theory, Base is a specie which accepts proton (H⁺) while, Acid is a specie which donate proton.

Bases
may contain a negative charge or lone pair of electrons, while, Acids contain positive charge or a neutral atom with incomplete octet.

In given statement KOH is acting as a base because it contains a negatively charged hydroxyl group which can accept proton from a acid, i.e.

                                    KOH    →     K⁺  +  OH⁻

Reaction of OH⁻ with any acid,

                         K⁺    +   OH⁻  +   HCl      →       H₂O   +   KCl
5 0
3 years ago
Read 2 more answers
Write 3 to 5 sentences about predicting the properties of acids and bases​
Nataly_w [17]

Answer:

cause of the properties of their aqueous solutions. Those properties are outlined below:

Aqueous solutions of acids are electrolytes, meaning that they conduct an electrical current. Some acids are strong electrolytes because they ionize completely in water, yielding a great many ions. Other acids are weak electrolytes that exist primarily in a non-ionized form when dissolved in water.

Acids have a sour taste. Lemons, vinegar, and sour candies all contain acids.

Acids change the color of certain acid-base indicators. Two common indicators are litmus and phenolphthalein. Blue litmus turns red in the presence of an acid, while phenolphthalein turns colorless.

Acids react with active metals to yield hydrogen gas. Recall that an activity series is a list of metals in descending order of reactivity. Metals that are above hydrogen in the activity series will replace the hydrogen from an acid in a single-replacement reaction, as shown below:

text{Zn}(s)+text{H}_2text{SO}_4(aq)rightarrow text{ZnSO}_4(aq)+text{H}_2(g)

Acids react with bases to produce a salt compound and water. When equal moles of an acid and a base are combined, the acid is neutralized by the base. The products of this reaction are an ionic compound, which is labeled as a salt, and water.

[10/31, 6:00 PM] Jana Taher: Bases have properties that mostly contrast with those of acids.

Aqueous solutions of bases are also electrolytes. Bases can be either strong or weak, just as acids can.

Bases often have a bitter taste and are found in foods less frequently than acids. Many bases, like soaps, are slippery to the touch.

Bases also change the color of indicators. Litmus turns blue in the presence of a base while phenolphthalein turns pink.

Bases do not react with metals in the way that acids do.

Bases react with acids to produce a salt and water.

Please note that tasting chemicals and touching them are NOT good lab practices and should be avoided in other words, don’t do this at home.

8 0
3 years ago
Other questions:
  • Why do northern lights appear in different colors? Because charged particles of solar wind ignite different gases in Earth's atm
    13·1 answer
  • Explain the states of solid, liquid and gas in terms of molecular movement and molecular packing?*​
    7·1 answer
  • Which of the following is NOT a characteristic of stars? A) Size B) temperature C) texture D) color
    13·1 answer
  • Why was a condenser not necessary in the final distillation
    10·1 answer
  • How does the abundance of various isotopes affect the atomic mass?
    14·1 answer
  • Both light and sound travel in the form of waves that are created by a transfer of ____
    7·2 answers
  • How many atoms of chlorine are represented below? 9NaCL
    5·1 answer
  • A cube has a mass of 42 grams and a volume of 15 cubic centimeters. What is it’s density?
    9·1 answer
  • For the balanced equation shown below, what would be the limiting reagent if 80.2 grams of N2 were reacted
    14·1 answer
  • Calculate the volume of a 0.225M solution of KOH required to react with 0.215g of acetic acid.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!