1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksklad [387]
2 years ago
6

Determine the empirical formula. a 3.880g sample contains 0.691g of magnesium , 1.84 g of sulfur , and 1.365 g of oxygen .

Chemistry
1 answer:
Aliun [14]2 years ago
4 0

Answer:

Mg S2 O3

Explanation:

.691 g of Mg  is .284 mole

1.84 g of S    is .5739 mole

1.365 g of O is  .8531 mole      you can see the ratio is ~  1 :2 :3

                                                        Mg S2 O3

You might be interested in
Imprints of the shells of ocean clams are often found in the rocks of the Appalachian Mountains. What do these imprint fossils M
Anit [1.1K]
A. It is the most reasonable answer
7 0
3 years ago
What are some chemacial changes in your school?
Oksanka [162]
Putting glue on something, because once it is set in you cannot change it back.
6 0
3 years ago
The solubility of k2cr2o7 in water is 125 g/l at 20 °c. a solution is prepared at 20 °c that contains 6.0 grams of k2cr2o7 in 50
Pachacha [2.7K]
The solubility is the guide to the maximum amount of solute that can be dissolved in a certain amount of solvent at a certain temperature to make a saturated solution. Any amount less than this would result to unsaturated, while any amount more would result to saturated.

6 g/(50 mL * 1 L/1000 mL) = 120 g/L

Since it is less than the solubility of 125 g/L, then <em>this solution is unsaturated</em>.
5 0
3 years ago
In cellular chemical pathways, the product(s) of any particular reaction are often quickly consumed by the next reaction in the
mezya [45]

Answer:

Tend to keep the product concetration <u>low</u> and therefore drive the reaction <u>righward</u>

Explanation:

The fact the products of a reaction are quickly consumed by the next one would tend to keep the product concetration low and therefore drive the reaction righward (to the products).

This happens because the system will not achive equilibrium between the reactants and the product, and will keep producing it util the system achives equilibrium or the reactants dry out.

5 0
3 years ago
Consider the addition of HBr to 2-pentene. Indicate the re
lana [24]

Answer:

This addition reaction yields 3-BromoPentane and 2-BromoPentane.

Explanation: The reaction is an addition reaction that follows the Markonikoff's principle engaging the electrophillic addition mechnism with electrophile having no lone pair so rearrangement of carbonation is possible. It yields two possible products.

5 0
4 years ago
Other questions:
  • Which sample of matter has a crystal structure?
    9·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Describe dmitri mendleev 's periodic table ​
    12·1 answer
  • C3H18 +<br> O2<br> +<br> CO2 + H2O<br> Balance equation
    7·1 answer
  • A compound that changes color when it is in contact with an acid or base is called
    13·1 answer
  • Identify the oxidizing and reducing agent in the following reaction, and determine which element is oxidized and which is reduce
    11·1 answer
  • Whag is the answer. please i need help​
    6·1 answer
  • This is the last week of school for me and i need help pleaseee !!
    7·1 answer
  • Name the chemical reaction HCI +<br> NaOH → NaCl +<br> H20
    6·1 answer
  • Helium only has two valence electrons and is a stable atom. How is this possible when atoms
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!