1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mario62 [17]
3 years ago
10

2.0 grams of ZnSO4 reacts completely with Li2CO3; how many grams of Li2SO4 would be produced?

Chemistry
1 answer:
grin007 [14]3 years ago
3 0
Moles of ZnSO4 = Mass/Mr
= 2/(65.4 + 32.1 + (16 x 4))
= 0.012383.... mol

Since there is no chemical equation provided, I will assume that the ratio of ZnSO4:Li2CO3 is 1:1

Therefore there are 0.012383 mil of Li2SO4 as well
So the mass would be Moles x Mr = 0.012383.... x ((6.9 x 2) +32.1 + (4x16))
= 1.360 g of Li2SO4 produced
You might be interested in
Melamine is used for making
vodomira [7]

Answer:

Melamine is used for making tableware,cooking utensils, plates, plastic products etc.

Explanation:

Melamine is used to manufacture many products. How? Well melamine-formaldehyde resin, as it's full name, forms molecular structures that are molded, with heat, to take the shape of the items such as tableware.

After this chemical reaction takes place, the "left over" remains as plastic.

_________________________________________________

And so, it is used in products such as cooking utensils, plates, plastic products etc.

3 0
3 years ago
Needed help plzzz on this chemistry homework.
mrs_skeptik [129]
Hertz is units for frequency. (waves per second)
wavelength = speed/frequency

if you're given the speed use that to calculate, if not then you can probably assume it's a wave of light and use the speed of light (3x10^8 m/s) to calculate.

wavelength = (3x10^8)/(1.28x10^17)
= 0.000000002 m
= 2.34 nm

5 0
3 years ago
Why does galium melt
levacccp [35]

Answer:

Like most other metals, Gallium is solid at room temperature (or liquid if it is too hot in your room). But, if it is held [in hands] for long enough, it melts in your hands, and doesn't poison you like Mercury would. This is because of its unusually low melting point of (~29 degree Centigrade).

- It melts once it reaches its melting point.

:)

7 0
3 years ago
When the temperature of the air is 25°C, the velocity of a sound wave traveling through the air is approximately
Vitek1552 [10]

Answer ; The correct answer is : 346 m/s .

Sound is a type of longitudinal wave , which is produced when a matter compress or refracts .

Speed of sounds depends on factors like medium , density , temperature etc .

Effect of Temperature on speed of sounds :

When the temperature increases , molecules gains energy and they starts vibrating and with higher temperature vibration becomes fast . So the waves of sounds can travel faster due to faster vibrations . Hence , speed of sounds is directly proportional to the temperature or speed of sounds increases with increase in temperature .

The speed of sounds at 0⁰C is 331 \frac{m}{s}

The relation between speed of sound and temperature is given as :

V = 331 \frac{m}{s}  + ( 0.6 \frac{m}{s- ^0C} * T  )

Given : Temperature = 25 ⁰ C

Plugging values in formula =>

V = 331 \frac{m}{s} + (0.6 \frac{m}{s-^0C}  * 25^0C)

V = 331 \frac{m}{s} + 15 \frac{m}{s}

V =  346 \frac{m}{s}

7 0
3 years ago
Nitric acid can be produced by the reaction of gaseous nitrogen dioxide with water. 3 no2(g + h2o(? ?? 2 hno3(? + no(g if 538 l
Phantasy [73]
The balanced chemical reaction is written as:

<span>3NO2 + H2O = 2HNO3 + NO

Assuming that the gases in this reaction are ideal gas, then we can use the conversion from L to moles which is 1 mol of ideal gas is equal to 22.4 L. We calculate as follows:

538 L NO2 ( 1 mol / 22.4L ) ( 1 mol NO / 3 mol NO2 ) ( 22.4 L / 1 mol ) = 179.33 L NO is produced</span>
8 0
3 years ago
Other questions:
  • Use the periodic table to determine the electron configuration for Cl and Y in noble-gas notation.
    15·3 answers
  • What is a type of air mass that forms over oceans?
    12·2 answers
  • Copper crystallizes in a face centered cubic lattice. if the edge of the unit cell is 351 pm what is the radius of the copper at
    5·1 answer
  • A piece of iron (mass = 25.0 g) at 398 K is placed in a styrofoam coffee cup containing 25.0 mL of water at 298 K. Assuming that
    8·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which is not an essential component of a voltaic cell?
    11·1 answer
  • ___1___Zn + __2___HCl → ___1___H2 + ____1__ZnCl2
    12·1 answer
  • SHOW ALL WORK AND INCLUDE UNITS
    7·1 answer
  • 6) A 14.5 g sample of sodium chloride reacts with excess fluorine gas according to
    14·1 answer
  • What are communication skills??
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!