Considering the definition of density, you obtain that:
- Part A: the density of gold is 19.3 g/cm³.
- Part B: the density of iron is 7.8 g/cm³.
<h3>Definition of density</h3>
Density is defined as the property that allows to measure the amount of mass in a certain volume of a substance.
The expression for the calculation of density is the quotient between the mass of a body and the volume it occupies:
density= mass÷ volume
It can be deduced that density is inversely proportional to volume: the smaller the volume occupied by a given mass, the higher the density.
<h3>Density in this case</h3>
In this case, you know that:
- A sample of gold has mass of 38.6 grams and a volume of 2 cm³.
- A sample of iron has a mass of 46.8 grams and a volume of 6 cm³.
Replacing in the definition of density:
- Gold: density= 38.6 g÷ 2 cm³
- Iron: density= 46.8 g÷ 6 cm³
Solving:
- <u><em>Gold: density= 19.3 g/cm³</em></u>
- <u><em>Iron: density= 7.8 g/cm³</em></u>
In summary, the density of gold is 19.3 g/cm³ and the density of iron is 7.8 g/cm³.
Learn more about density:
brainly.com/question/952755
brainly.com/question/1462554
#SPJ1
They carry 50%of genetic information
Answer: Oxidation of Glucose,Glycolytic reactions
Explanation:
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
You have given no demonstration based on your microscopic investigation so I cant tell you the answer to the question. I will try to help you by elaborating how to decipher..
Three terms hypotonic, hypertonic and isotonic are used when referring to two solutions separated by a selectively permeable membrane.
The hypertonic solution has a great concentration of OAS than the solution on the other side of the membrane. It is described, therefore, as having a great osmolarity. The hypotonic solution has a lower concentration of OAS, or osmolarity, than the solution on the other side of the membrane. When the two solutions are at an equilibrium, the concentration of OAS being equal on both sides of the membrane, the osmolarities are equal and are said to be isotonic.
The net flow of water is from the hypotonic to the hypertonic solution. When the solutions are isotonic, there is no net flow of water across the membrane.
If red blood cells are placed in a solution with a lower solute concentration than is found in the cells, water moves into the cells by osmosis, causing the cells to swell; such a solution is hypotonic to the cells.
So, look at the information and data you have on your microscopic investigation and use these guidelines to tell you which is which.
